Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8390  (registered. 2012)
Contig Information
Length 574 bp
Clones alternative view 23 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_VHS Shoot with heat shock treatment 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XE Seedling, infected with leaf rust 5
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226504448|ref|NP_001146988.1|| 60S ribosomal protein L44 [Zea mays]
Score 221
Evalue 3.00E-56
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8390
GCACGAGGGCACGAGCCCCGCCGACGACGACGACGACGACGCTAACCGACCGAGCGCGAGCACCGCACCGCCGCCGCCGCCGCCATGGTGAACGTTCCGA
AGACCAAGAAAACCTACTGCAAAAACAAGGAGTGCAAGAAGCACACGCTTCACAAGGTCACTCAATACAAGAAGGGTAAGGACAGCCTGTCTGCCCAGGG
AAAGCGTCGTTATGACAGGAAGCAGTCGGGATACGGTGGTCAGACCAAGCCCGTTTTCCACAAGAAGGCAAAAACCACCAAGAAGATTGTGCTGAAGCTG
CAGTGCCAGAGCTGCAAGCACTACTCCCAGCGCGCCATCAAGCGGTGCAAGCATTTTGAGATCGGTGGAGACAAGAAGGGCAAGGGAACGTCTCTCTTCT
AGATTGCTTTCACCTATCTGGAGTCGTTGTGGTCAAGAACTATTACTACTTGTCTTGATGTTTTTGATGTTATGAGTTGAATTGACCAGACCTTCTAATG
TATCCAAACCCCTTTATCTGGCATTTGAGCAAGGACCGACTTGGCAAAATGATCTTTTGTGGCTAAAAAAAAAA
page-top