Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8383  (registered. 2012)
Contig Information
Length 761 bp
Clones alternative view 30 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 5
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XA Root 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242093418|ref|XP_002437199.1|| hypothetical protein SORBIDRAFT_10g022750 [Sorghum bicolor]
Score 199
Evalue 2.00E-49
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8383
TTTTTTTTTTGATCAAAAGCAAGGCAACTTTAATTTATTGATTTTGCGACTAAAAGCACAGTAAATCTCCTCTGCCGTCGGCCACATCGGTGCCTCCGAC
GATGCCAGATTCCAGATCCAGTACACCAGAAAGTCGAAGCGGGAACGGGAACAGAAACAAAATCTAGTTGGCCAGATCTAATACACATCGACGCTGTAAG
CACTGAGGAGCGTACCAGGCGGCGGCAAGTGTCCATCCGACTAGTTCGCTTAGTTGGTTCCATCCCTGCGCAGGGCAGGGGCCTCCGGCGCCGCCGGGAC
AGGCTGGTAAGCCTTGTCCTGGTGGATGAAGAAGGCGTAGAAGCCGCCGCAGGTGGTGGCCGCTGCCATCGTCCAGACGACAATCTTGACTGCCAGAGGC
ATGATTTCAGCGACTTTATAGCTGAACATGACGGTGAGGAGGCTGGTGAGCGTCCAGACCGCTGCCTTGATCGTCTGCCGGCGAGGAGAATGATAGTCCA
AATCTTTATAAAGTCGCAGACATGCGACAAGGGCAACCAGGTTCAAGTAAGAGAACACAACGAAGACTATGGAGCCCGCGTCGCCGTTGGAGCGGTAGAT
GGCCATGCCGGAGTTGAAAGTGAGGAAGCAGAAACCGAGAATCGTGAGACACGACAAGTCTGCCATTGTTGGAAGTGGTGGTGGTGACGTTCACTGCAAA
GGAGTTAGCCAGCGTTTATGTACCTTGTACTTATTTATCAGCGGTGACTTCAGCGGCACGA
page-top