Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8382  (registered. 2012)
Contig Information
Length 599 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XA Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115435592|ref|NP_001042554.1|| Os01g0242300 [Oryza sativa (japonica cultivar-group)]
Score 277
Evalue 6.00E-73
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8382
CCGTTGATCGCCCACGCCCAACATTCGGGGAGGAGGAATAGCGGAGGAGGAGGAGGCCAAGGACCGCCGCCGCCGCCGCCGCCATGGCCGCGCTGCCGGT
GATGAAGCTGGGGACGCTGCTGCTGCGGACGCTGTCCAAGCCTATCGCCAACCGCCTCAAGAGCCAGGCCGCCGTCCACCCCAAGTTTCGTGACTTCATC
ATCAGCATCGCCCAGACAAACCATCGTATCACTACAAGGATACAAAGACGCATTTACGGGCATGCTACTAATGTGGCTATCAGACCTTTAGATGAGGAGA
AGGCAGTACAAGCTGCTACAGATCTCATTGGAGAAGGCTTCATCTTTTCGGTTGCTGTCGCCGCTTTAATTTTCGAGGTGCAAAGAAGTGCTAGGTCAGA
GGCTAGAAAGGAGGAAGCTCGTAAACAGGAACTTGAGGAACTGAGACAAAAGGAAGAGATTCTAGCTAAAGATTTAGAAGATCTCAAGGTGAAGCTGGCT
GAACTTGAGCGCCTCGCCAAAGGCCGGGGCCTTTCTGGAATATTGAACTTCAAAGGTGTCAATGCAGCAGATAGCAGCAAGGAAGCAACACCTGCTTGA
page-top