Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4961  (registered. 2007)
Contig Information
Length 406 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_15333 [Oryza sativa Indica Group]
Score 86
Evalue 0.320886
Total Hit Count 8
Registered year 2007
Contig Sequence     [ Download ]
>Contig4961
gggcgagcctatcccggaacgtgaaggagatccgcttcctcttctgccagtcttcccctccgaagCCCATGGCCGCGGCCGTCGCCCATGCCACCGAAGC
CATCCCCGCCGAAGGCCGCTGCCAAAGCCAATGGCTACTAGTTGTATCCGCGTCGAGCAACACTAGCAACAACTGATGGGTGTACGTCGGTACGCGACGA
AGGTCTATGCACACAtacattcaaaaaggacgatatgaatatatgaaggcgccctatatgattgctacattttctttcttacgacaaaggatgaatttta
tttactccctcaatccatatatatatagtgtctaatatattttcgagatggtctttgactattgataagattaatagtatatgagatgtataatgtaaaa
ttatat
page-top