Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4959  (registered. 2007)
Contig Information
Length 551 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0732000 [Oryza sativa (japonica cultivar-group)] >gi|57899150|dbj|BAD87012.1| unknown protein [Oryza sativa Japonica Group] >gi|57899708|dbj|BAD87428.1| unknown protein [Oryza sativa Japonica Group] >gi|113533683|dbj|BAF06066.1| Os01g0732000 [Oryza sativa (japonica cultivar-group)] >gi|218189006|gb|EEC71433.1| hypothetical protein OsI_03631 [Oryza sativa Indica Group]
Score 199
Evalue 3.58691e-14
Total Hit Count 32
Registered year 2007
Contig Sequence     [ Download ]
>Contig4959
gcagaggcggccatggagaaggggaAGGCCCCAGcgg*agGCAGCGGAGTCGGCGGCGGCGTGTGCGGCGCGGCTGGCGCGTGAGTGGAGCACTTGGGCG
ATGAAGAACGCGAAGGTGGTCGCGCACTACGGCTTCATCCCCCTCGTCATCCTCGTCGGCATGAGGTCCGAGCCCAAGCCCAGCCTCGCGCAGCTCCTCT
CCCCCGTGTAGCTATTTTCCGCGGCCCGATCCGCACGGCTGTGCGCGTATTGAATTGATCAACATTCGTATTTCTCCCCAATAATTTCGATTACTCTTTG
GATTGCTCTGATTTGGGGTCTCCTTGATTGCCACCGAGAACCTACCAGCTAGTTTATCTGTATGATTATTAAGCTAGGAGCTACAATTAGTTGCAAATAC
TGGTATCGTGAGAATGTATTAGAGTCTCAAGGACGAGTTCGTGTTTCACCCTTTGAGATGGGAGGTgttagGTGTCACCGTGGGAGCAAGCGCAGGTACG
GTGTTTATAAGatttctgatgtatgatgtatttgggagtagaaaaaaaaaa
page-top