Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4953  (registered. 2007)
Contig Information
Length 320 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit MIKC-type MADS-box transcription factor WM13 [Triticum aestivum]
Score 165
Evalue 2.23366e-10
Total Hit Count 86
Registered year 2007
Contig Sequence     [ Download ]
>Contig4953
gtcggcggccgacaTGTACGCCTTCCGCGTGGTGCCCAGCCAGCCCAACCTGCACGGCATGGCCTACGGCGGCTCCCACGACCTGCGCCTCGGCTAATCG
ATCATCTCGATCGCTCCTACTAGCTTATAGTATATCAAGTGATCGATCAAGTTGTTCAAGTTACCACAATAAGAAAAAATCTGTGTGCTTGTATTTGTCA
CATGTTGTGATCGATGATGCCTTATGTCGGTCTTCGTGCACATGATTCAGTTCAATGTGTAATTAACGCCGTAGTGCTCGACTGTGTATTGTATTGTatg
atCTGCTatgactttggttg
page-top