Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4942  (registered. 2007)
Contig Information
Length 591 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_19960 [Oryza sativa Indica Group]
Score 471
Evalue 1.24979e-45
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig4942
ggtataTGCTTGTCTCAAAGATTAAGCCTGCATGTGCAAGTATGAACCAATTTGAACTGTGAAACTGCGAATGGCTCATTAAATCAGTTATAGTTTGTTT
GATGGTACGTGCTACTCGGATAACCGTAGTAATTCTAGAGCTAATACGTGCAACAAACCCCGACTTCTGGGAGGGGCGCATTTattagaTAAAAGGCTGA
CGCGGGCTCTGCTCGCTGATCCGATGATTCATGATAACTCGACGGATCGCACGGCCTTCGTGCCGGCGACGCATCATTCAAATTTCTGCCCTATCAACTT
TCGATGGTAGGATAGGGgcacgctgctgatttccaagatcagggaggagtacccggaccggatgatgctcaccttctccgtgttcccatcccccaaggtg
tctgacaccgtggtcgagccctacaacgccaccctctcggttcaccagctggtggagaacgccgacgagtgcatggtgctggacaacgaggcgctctacg
acatctgcttccgcaccctcaagctgaccacacctagctttggtgacctgaaccacttgatcagtgccaccatgagcggtgtcacctgctg
page-top