Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4938  (registered. 2007)
Contig Information
Length 591 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_00078 [Oryza sativa Indica Group]
Score 293
Evalue 5.45902e-25
Total Hit Count 40
Registered year 2007
Contig Sequence     [ Download ]
>Contig4938
gtCTGCACAAGCAATGGCTACCGCAAGAGGGGCTAGTGGTGCCTCAATGCCCACCATCACCCCTACCACGAGTGGTGGTGCAGGGTCACCAGAAGGAGAG
AAACATTGGGAGGCATTGGCACCGGTGGTGGAGGTGCAACAACACGATGATACAAGCATGGATGTGGTGCTGGTATGCAGCAAAGAGAGGCCGATCATGC
TCCACCAGGTGATCACCATCCTCGAGGAAGAAGGCGCCGAGGTCGTCAATGCCAATCACTCCATTGCTGGCCACAAAATCTTCTACACCATACACTCCCG
GGCCTTCAGCTCGAGAATTGGCATAGATGTTTCAAGTGTTTCCGAAAGACTGAGAGCATTGGTATGATAGTAAATTTGTTTGTATAAAATATATATCCCA
TAACTATATATAAAGAGAAAATCCCGCATATGGTACATATGTCTAGTTATTAGCTAGAAGAACGGGATGGGAACACCCTTCAGTAGCTATATAACATCTT
CTTCATGTTGTTTTCACAACATGATCAATGTATGGAAAAGGATGTTGACTGATCTgtgatTTTTCActgacTTCTGGGCTGTCACGGCTtg
page-top