Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4935  (registered. 2007)
Contig Information
Length 789 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit L-ascorbate oxidase precursor [Zea mays]
Score 286
Evalue 1.51532e-27
Total Hit Count 410
Registered year 2007
Contig Sequence     [ Download ]
>Contig4935
aattcggcacgagggacgcctccaacccgcccatgttcaacgtggaggccggcaagacgtaccgcttccgcgtctgcaacgtgggcatcaagaccaccct
caacgtgcgcatccagggccacgtcctcaagctgGTCGAGATGGAGGGCTCCCACACCGTGCAGAACGAGTACGACTCAATGGACGTCCACAtcgggcCA
GTGCCTCTCCTTCCTCAGCACCGCCAACCAGAAGCCCGGAGAGGTACTACCTGGGGGAGCAGCTGTACGTGAGCTGCACCTCGCCGGCCAGGTCGCTCAG
GGACGAGTACAACATGCCCGACAATTCCCTCCGCTGCGGCAAGGTCGTCGGCATGCCGCTGCCGCCGCCCTACACCATCGCATAAATTACTCTCCCCCAG
CTCCATTAATTCCACTCCACTCCCCTCCATGAGAGAACGCTTGCATGCATGGTGCTGTACACACTACGTACGTACAACGACAACAACAGGAAGAGCAGGA
GAGTTTTTTCGTTTCTTCTTTTTTTTCGTACGCCCCCACGTCCACTCTTCTTCTTGTCAGGTTCACTCTCTCTTTTCGAGGAAAATAAAAACAACAACAA
AGGGGGGCTCATCGTCATGTGGGCGCCACCTGTCATCGGAACGAGGATGATGATTTCAGAACAAGAAGAAGAGAGATTGGCcggatacgaagctcgatcg
ggacgccctctcgaatcgtttacgttgtaataggagttaattaattctatctganatcatcatttatccaataagtccttcgggcaaat
page-top