Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4934  (registered. 2007)
Contig Information
Length 687 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown protein [Oryza sativa Japonica Group]
Score 137
Evalue 9.57261e-07
Total Hit Count 12
Registered year 2007
Contig Sequence     [ Download ]
>Contig4934
gagccgtgggttcagctcgagtacgtgctcgagggaaaagacgccgtacgcgcggcgggtggagttcgggctccaggaaaaacactaccatgtcatctct
gtgctcgggttcttctccacctccttcttcttcgttggttcgtgccacggcaagtgagggcgagctagaGAGACGGAGCTACGGCAACAACACAGGCTAC
TACCCGTCGGCGGCTGCGGAGAAACGGCAAGCCGGCGGCGGGAAAAAGTCGCACCGGGGGAGCACCAAATCCAGGGGCGAGAAGGGATTCATCGAGGGAT
GCCTGGCAGCGCTGTGCTGCTGCTGGATCTGCGAGATGTGCTGCGACTAACCCGGCGTGGTCGCTGCTGGCAAAAGACGTTGCTGCTAGTGCCTATGAAG
AACATACACATACAGAGAGTCGATGCTTAATTACAGTGTCTGTCTGTTTGTTTGTTGTTTTAGGTTCTGCGTAAATAACCGAGAACCCGTGCTGCGTGTG
TGATGCCCATGTACCATGCGTCACACCTATAATCAATTTTAAGGCACCAAATTATCGGGCTACTCTTGAAGATCCTCTAGTTAAAGATAACGTCTGCTGT
GCAAAAATGAAAGCTTTCATTTGTAGAGGGAGAAGTCGTGCAGGCGTAATCAGtcagtcacttgtccagagttttttttttttttga
page-top