Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8369  (registered. 2012)
Contig Information
Length 626 bp
Clones alternative view 48 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 4
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 12
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242081871|ref|XP_002445704.1|| hypothetical protein SORBIDRAFT_07g024460 [Sorghum bicolor]
Score 186
Evalue 2.00E-45
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8369
GCACGAGGCCTCGTGCCGAATGAGAGAGAGAGAGCAGTGTAGGGACATCCTGAGTGACCACCGGAGAGAGAGAAGAAGAAGAGGCTGCCAAGGTCGACGG
CGGAGAAGAAGAGGCGATGGCGTCCGGGTGGGGCATCAACGGGAACAAGGGGCGGTGCTACGACTTCTGGCTGGACTTCAGCTCGTGCATGAGCCGCTGC
CGCCAGCCCTCCGACTGCGGCCTCCTCCGCGAGGACTACCTCGAGTGCCTCCACCACTCCAAGGAGTTCCAACGCAGGAACAGGATCTACAAGGAGGAGC
AACGTCAGATAAGAGCTGCTGCTCGCAAGGCCAAGGAGGAAGCCGAAGGAGCTCCTGCTGTTGCAGCTCACCACTAGCATCCCTTTTCAATTTTTTTCTT
ATGCTTTTGTTTGTTGCAAGCGCTTCCATGTTCGGCTATGAGCAAGGCAATAATTACCTAAACATTGCACCCTCCCACCTCCATGACTTGTTCTAAAAGC
ATGAGTTTGATAAACTACCTTGGTCATCAAGTTTGTGCATGTTTGAGATATTAAGCGATAATAAACGCTTGATTCAATCATGAAACATGATGTTTGTGCA
TGTCTGCATATCTTGTAAAAAAAAAA
page-top