Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8368  (registered. 2012)
Contig Information
Length 950 bp
Clones alternative view 121 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 14
Wh_e Seed DPA10 9
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 1
Wh_r Root 3
Wh_yd Spikelet at late flowering 9
Wh_CSEC Callus 6
Wh_EM Dormant seed with water absorption 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_KMP Shoot grown under continuous light 4
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHC Shoot grown with cold treatment 5
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 5
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_CA 1
WH_SP 7
WH_XA Root 10
WH_XC Root, treated at 50 microM Al for 6h 12
WH_XD Root, treated at 50 microM Al for 6h 9
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|57471724|gb|AAW50993.1|| ribosomal protein S7 [Triticum aestivum]
Score 382
Evalue 4.00E-104
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8368
TTTTTTTTTTGCAGTGACTAAGCATAGATGTTGAACAATTAGAGATGACAATCAAGTGCAACAAGATAACGGAGCATAGGTTCATAATTTAAATGCTCAA
AACTTTAACATTGTTCACGTTCATTGCCATCTTCATCAAACTTCCTAACCCCAGATAGTTAACAAAACTATGTTTCTGGAATACATTGATAGCACAACTA
ACCAAGACCTCAACCAAAACATTTGGATCAGAAAGATATGAAATGGAGACATTCAAGGCATGGATCTTCAGGCGGTTTCAGTCACAGGGTACTCAAAGAC
AACGTCTTTCCCACAAAGCCTGCGGTAGACTGCAGAGAAGGTCTCCAGCTTGTATTCAGTGTTGTTGCGCTCCTTTGGGTCCAAGTAGATCTTGATGACC
TTGGCACCATCCAAACGGTATCTGACACGCTTCCCCACAATCTCAGCTGGGTACACGACATCCTCCAAGATACCATCATGAACAGCTGTCAGGGTCCTGG
TGCGAGGGCGCTGAACAGCAGAACCCTTCTTGGGTGGCCTCACAATCCTTCTTGTTGCAACAAAGACCACATCCTTGCCGCTAAACTTCTTCTCCAGCTC
CCTGACGAGCCTGACATGGATCTTCCTGAAGGGCTTGCGCAGACGGTACGGCACATGGATCACCACGGCCTTCCTGTTGCCAACAACATCCATCTGGATT
GCAGTGTTGATGTACAGGTCCTTGAGGTCGCTCTTGAGCTCCTGGTTGCCATTCTCCAGGTCAAAGAAAGCCTGCGCGACGGTGTCCTCGAACTCGGAGG
GCTCGACGCCCTTGTCCTTCTGGATCTTCTTCCTGGCGGTGTACATCTTGCTTCCCTTTCGCCGGGCCCTGCGCGCGAGGAGAGGAGGGAGCAGAGAAGT
GGAGGCGCCGGCCCTCGTGCCGAATTCGGCACGAGGCGACGGAGGTGGTG
page-top