Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4656  (registered. 2007)
Contig Information
Length 576 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit AEL244Wp [Ashbya gossypii ATCC 10895] >gi|44983259|gb|AAS52441.1| AEL244Wp [Ashbya gossypii ATCC 10895]
Score 90
Evalue 0.178643
Total Hit Count 4
Registered year 2007
Contig Sequence     [ Download ]
>Contig4656
ttcGGGgaataCTCcaaaattcGCGTATCCCGCCTat*cccgCCGTATCCCCGTATCCCGCCGTATCAGGACGGCAGTTCGGCGATTCCTGGCGTGTCCG
TGCTTTTTAGGTGAGGACAGAAAACCAAACCAGCATTTACAGTCCTCAAGAAGAAGACTAGAGATTGGTTGGCAAAAGATACATCATCATTGGCAAATAT
TAGTATCACATATAATAAATAAACCCAAACGATAACCAAATACCTATCCAAACAACAGAGCTGGAAAGCAGCACATACGACTACAACATTAATCAGCAGC
TGCAGGTTAAGTGCTGTGCATAAATATTTTAGGATCCAAAAAAATATTGTTACCTATCCAAACAGAGCTAGAACATGAATATGCAACAAATCTACTACGC
TCAAACACAGTTGATAAAAAAAATTTAACATTCTGGCATAAACTGAAATCAAACAACATAGCATGAATTCCATCCAAATTAATATTCGATTTCTAGCTTG
ATTTTGTTGTTTTTCGTCCTAATTCGAAATTTCCCCACCAAAAATAGCCCCAATTTTTTTTTTtgngaTTTGTtgg
page-top