Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8342  (registered. 2012)
Contig Information
Length 679 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 1
Wh_SHC Shoot grown with cold treatment 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XA Root 1
WH_XF Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115458610|ref|NP_001052905.1|| Os04g0445800 [Oryza sativa (japonica cultivar-group)]
Score 246
Evalue 1.00E-63
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8342
TTTTTTTTTTAAGAATACAGGGCCGGTACATTGCTACTGAGGAAGAGCCCCTCGGTCCAGAGCATTAGGGCTGAACAACAAGTATAAGACACAGTGCAAT
CAGGAGCTTCCATTGCCCACAAACATAGCAAATGCCGCCATTAAAAACCAGCGGCCACAAAGGGAGCACCAACTATCAATCAACATGACTGACTAATGGA
TGGACGCTAATCGAAGTCTAGGAACTCCATCCTCTTCCTCATTGTGCCTTTCAGATCCCTTGCTTCCTTTTCGGCTTTCTCGGCCGTTCTTATTTCAGCC
TCTGAAACACAAGTCATGTGACTAGGGAGTTCGTCCTTCTCACGATCCAGTTCTCCAATTAATACAACATTCTCTCCCCGGATCACATATAAACCAAGAG
GAACATCACAATATAATTCGCCCACAATTACTCGTTCACAAGCACCCTGAAGAACAACATTTGCAAACTGATCGAATGAGCAGAGGGTGCCAAGCAGCTT
TCGTCCATCTCGTAGTAGGACAATTAGTTTTTTATCCAAGAAGCCGGCCAGGGAGGTGGAGAGGAGGATCTCGTCGGGCCCGGCCCAAGACATCGCGCCG
AACCCAAATCCGGCGCTAGAAATAGCAGTAGATGGCCCTGATCGGCCGCTTCTTCGATTGGAGCTCTGTGGTTCGCCGT
page-top