Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4487  (registered. 2007)
Contig Information
Length 870 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_35453 [Oryza sativa Indica Group]
Score 505
Evalue 3.16164e-49
Total Hit Count 126
Registered year 2007
Contig Sequence     [ Download ]
>Contig4487
aggctgcagccgacagaataaaggcacaggccttatcaaatgcaaagggattgagcagggctcaagctgaacgtgcagcggaagctgccgctcgcaatgt
caatgcctatgggcagaaggaagagggaccaagtcgctggcaggagaggaaggaagccaagaggcagatgtatctgatgagtacagagaaggctgtgagg
ctgggtgtgaGGCCAAATGCTGCACCAGCTTCTGCAACTGCTGGGGGCCAATGTCAGAAGTGCTTCCAGCCTGGGCACTGGACATACGAGTGCAAGAATG
AACGGGTCTACATATCGCGGCCCTCAAGGACGGATCAGCTTAAGGACCCCAGGTTGAAGAAGGCGTGGCTGCCGGCGCCCTCTCAGTTTGTGAACCCTGA
TCTGAAGAAGAGAAGGCACCGTAGGGATAGCACGTCGTCCTCCTCCTCTGGATCTGAATCTGAGTCCGAGTCTGATTCCGATTCTGACGGCAAAGGCAGC
CGGAAGAAGAGCAAGAAGCACGGCGACAAGCGCCGATCCTGAAGAACTGGAGAAGGCGCCAGATACGGCCAAATTCTGCCCACATATCATGTCCTTTTCA
CTGCAGCCCTGGCTTCGTGTGCCGAGCGCCCTTTCAAGAGATGTATCGCGAATGTATGAGTTGATTTCCTGAACGCTAGATGATTtcctgttattgttct
ccctgtgctaaggagtaccctcttttatcctaaagattactaagaacttggaagtgcttgaagctatggattgtttcctatcccgtgatgcctgtgagca
tcagaaaatcctgcaactgtattctcccatcatctgtaagcttgttgtgctnaactgctggcaataatcg
page-top