Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4481  (registered. 2007)
Contig Information
Length 557 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Profilin; AltName: Full=Minor fruit allergen Mus xp 1; AltName: Allergen=Mus xp 1 >gi|14161635|gb|AAK54834.1| profilin [Musa acuminata]
Score 607
Evalue 1.81826e-61
Total Hit Count 468
Registered year 2007
Contig Sequence     [ Download ]
>Contig4481
gggagagaaaaaagatcccgcgagcaggcgagcgaggagggaggaggatgtcgtggcagacgtacgttgacgagcagctgctctgcgacatcgaCGGCCA
GCGCCTCACCGCCGCCGCCATCCTCGGCCACGACGgcgccgtctgGGCGCAGTCCGAGCCCTTCCCTGAGGTCAAACCTGAAGAAattactGCAGTACTA
AATGACTtcgatGAACCAGGCTCTTTAGCACCAACTGGATTATTCCTTGGTGGTACAAAGTACATGGTTATTCAAGGTGAACCTGGGGCTGTCATTCGGG
GCAAAAAGGGGTCAGGAGGGGTTACAATCAAGAAGACGAGTCTAGCCATTATCATTGGAATCTACGAGGAACCAATGACTCCTGGACAGTGCAACATGGT
GGTTGAGAGGCTCGGCGATTACCTTCTTGAGCAGGGCTTCTGAACTCAGAGTCCTAGTCTGGGCCAACTGGGCTTATGCCTATCGAAATGTActaccgCA
TACCCCATGAATAATTAGCACACATCCGGATATGTTTGAACAAGTGGTGGTTACTcg
page-top