Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8331  (registered. 2012)
Contig Information
Length 661 bp
Clones alternative view 47 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 4
Wh_CSEC Callus 4
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XA Root 3
WH_XB Root 4
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242082283|ref|XP_002445910.1|| hypothetical protein SORBIDRAFT_07g027890 [Sorghum bicolor]
Score 227
Evalue 7.00E-58
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8331
CCCTCGTGCCGAATTCGGCAGGAACAGAATCGACCCGGAGGGAGGAAGCAGCAGCAGCAGGTCAGCGAGGGAGGAGTAGAGGGGATGGCGGACAAGAAGG
GCGGAGCGCCGAGGAAGGAGGAGGTCGTCACGAGGGAGTACACCGTCAACCTCCACAAGCGCCTCCATGGCTGTACCTTCAAGAAGAAGGCACCTAATGC
CATCAAAGAGCTCAGGAAGTTTGCACAGAAGGCTATGGGCACGACAGACGTCAGGATCGACGTGAAGCTCAACAAGCTCATCTGGAGCAGTGGGATCAGA
AGCGTGCCCCGTAGGGTTCGCGTGAGGATTGCCCGCAGGAGGAACGATGAGGAGGACGCCAAGGAGGAGCTCTACTCACTCGTCACCGTTGCCGAGGTGC
CTGCTGAGGGTTTGAAGGGGCTGGGAACCAAGGTCGTCGATGACACTGAGTAGACTCTTTTCTTTATCTACATCGTTAGAATGAGCTGTTATTTGGAATT
GCACCAGCATGCTTTTTGTATCCCGCAGAAGTTTTGGAGTATGGAATATCGGGAGCTATCTATTTTCCTTCATCTAAATCTTGATGATTGGTTTTGTCCT
TCATACTGTGCTCGTTATTGGCGTCAATACAGGATGTGCAGTTGAGCTTGCAAAAAAAAAA
page-top