Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8328  (registered. 2012)
Contig Information
Length 1901 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_CSEC Callus 3
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_OKCS Seed DPA5 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XA Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115462083|ref|NP_001054641.1|| Os05g0147400 [Oryza sativa (japonica cultivar-group)]
Score 983
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8328
GGCCGGATCCTTCCTTCCCACCCCTCCCCGCCGCTCCGATCCGCCGCCGGCCGGCCAGCCGCCGCCATGTCGATCCGCATGCTGAACCAGAACGCGGAGG
TGATGAACAAGTCGGCGGCGCTCGCCATGAACATCGGCGCCGCCAAGGGCCTCCAGGACGTCCTCAAGACCAACCTCGGCCCCAAGGGCACCATCAAGAT
GCTCGTGGGCGGAGCTGGCGACATCAAGCTGACCAAGGACGGGAACACCCTCTTGAAAGAAATGCAAATCCAGAACCCAACGGCAATCATGATTGCGAGG
ACGGCGGTGGCGCAGGACGACACGAGTGGCGATGGCACCACGTCCACTGTGCTTTTCATCGGGGAGCTTATGAAGATGTCTGAGCGATGCATCGAAGAAG
GTACTCATCCACGGTTTTTGGTTGATGGCTTTGAGGTTGCCAAGAAAGCAACTCTTGAATTTCTCGAGACATTCAAGACAGCAGTCGTTATCGGTGATCA
ACCTGACAGGGAGATCTTGAAAATGGTAGCAAGAACAACTCTTAGGACAAAGCTGTATGAATCATTGGCTGATCAGTTGACCGATATTGTTGTGAATGCG
GTCCTATGCATCCGCCAGAGTGATCAACCAATTGATCTTTTTATGGTGGAAATAATGCATATGCGCCACAAATTCGATGTCGACACACGTCTGATTGAGG
GTCTGGTCCTTGACCATGGTTCTCGGCACCCTGACATGAAGCGCAGAGCAGAGAATTGTTACATCCTGACAGCTAATGTGTCACTGGAATACGAGAAAAG
TGAAATCAATGCAGGATTCTTCTACTCAAACGCAGAACAAAGAGAAAAGATGGTTACTGCAGAGAGGCGTCAAGTTGATGAACGTGTCCAGAAGATCATT
GAATTGAAAAATAAGGTTTGCGCAGGAACTGACAAGAATTTTGTGGTGATCAACCAAAAGGGCATCGATCCTCCATCCCTCGATCTCCTAGCTAGAGCTG
GGATTATTGCTCTCCGAAGAGCGAAGCGGAGGAACATGGAGAGACTTGTGCTAGCATGTGGCGGTGAAGCCATCAATTCAGTTGAAGGCATGACTGAAGA
CTGTCTTGGCTGGGCTGGGCTTGTCTATGAGCATGTTCTTGGAGAAGAAAAATACACGTTCGTGGAGAATGTTAAGAACCCTCACTCCTGTACAATTTTG
ATCAAAGGACCTAATGATCACACCATTGCACAAATTAAGGATGCCGTACGAGATGGTCTAAGATCTGTGAAGAACACAGTTGAGGATGAAGCTGTTGTGC
TGGGGGCTGGAGCGTTCGAGATGGCTGCAAGGAAGCATCTCATTGACAATGTGAAGAAAACCGTTAAAGGACGAGCCCAACTTGGGGTGGGGGCATTTGC
CGATGCTCTACTCGTTATCCCCAAGACGCTAGCAGAGAATTCGGGCTTAGATACCCAAGATGTTATTGTCTCTCTTGAGAATGAGCACGACCGTGGGCTG
GTGGTGGGGCTGAACCACAACAGTGGCGAGCCGGTCGACCCTGAGATGGAAGGCATCTACGACAACTACTCGGTGAAGCGCCAGATCGTGAATTCCGGAC
CCATCATCGCGTCGCAGCTGTTGCTAGTGGATGAGGTGATCAGGGCAGGGCGCAACATGAGGAAACCAACCTAAACCCAGCACTCGCCCCTTCTAGGCCG
AGACAAGTTTTTGTTTGGCTATTTTTCTCTCTGGTGCCGAGTACTTAGCAAGTAGTGATGTGGTGGGGGTGGAATGCTTGATTGGAAGAGATTGTACTTG
TAACGACCCTCGTGACAACGTTTGTATGCAGAATGTTTTCGTGTTGGATCAAAGTTGAGCAGCTATGTATTTTTGTGTGTGCGTGCGTCTGGTGATTGCA
T
page-top