Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4411  (registered. 2007)
Contig Information
Length 709 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0563200 [Oryza sativa (japonica cultivar-group)] >gi|113639931|dbj|BAF27236.1| Os10g0563200 [Oryza sativa (japonica cultivar-group)]
Score 930
Evalue 1.12513e-98
Total Hit Count 419
Registered year 2007
Contig Sequence     [ Download ]
>Contig4411
atgagtgtaattggaggaacaaaaggaaaatacttggtgtcatgatgaactggctcgagtgggtcctatcacagtcgcttcttcggattgcggagtgcaa
tccatatggcatggatgacttctggttgcagcagggcacatcaatgctgctgagcctggtgaagagctcacaggaggatgtgcaggagcgtgcagctaca
acaattgctacatttgtggttattgacgatgaaactgcgaatgtggatgctgcaaggtcggaggcggtaatgcgggatggaggcattccacttctgctgg
accttgcaaggtgctcaagggtgagtgcacagtctgaagcagcaaaggctattgccaacctatcggtgaatgcaaaggtTGCAAAGGTGGTTGCAGATGA
AGGAGGTATCGCCATTTTCACTAATTTGGCTAAGTCGACGAATCGACTTGTTGCTGAAGAAGCTGCTGGTGGCCTTTGgaatctCTCCGTGGGTGAGGAG
CACAAGGCGGCTATTGCGGCAGCTGGTGGTATAAAGGCTTTGGTTGATCTTATATTTCGTTGGCCTGCTGGGACTGATGGAGTTCTTGAACGTGCTGCTG
GTGCGCTTGCAAACCTAGCTGCTGATGACAAGTGCAgcctgGAAgtcgcAAAGGCTGGTGGTGTCCATGCTTTGGTTACACTTGCTCGATCATGTAAAct
tgagggcgt
page-top