Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8314  (registered. 2012)
Contig Information
Length 516 bp
Clones alternative view 53 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_r Root 1
Wh_DPA20 Seed DPA20 8
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 2
Wh_VABA Shoot with ABA treatment 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_SP 1
WH_XA Root 5
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 7
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig8314
TTTTTTTTTTTTGAGAAGGAATAATAATAATATTAAACAAGGGAATATAAGAAGGCTAAATATAAGCCTATACTGACAGGCGATTCTTCACATCAAAAGT
TGACTCAAAAACAGATCCAACAAACCAAATCACAACCACAACCAGAGAAAAAAAAGAGAGCACAAGGCCAGACGGCTATCCTATCAGGCAGTACTACATG
AAGCAACTAGTGGACTGGAGCGAAGGGAAGCAGACGGCCGGGGTGATGCGATGGATGGATCGATCAGCGCTTGATGGCCTTGACCTTGTTCCACGTCTTC
TTGCCGAAGTCGCCGACGACCCTGACGCCCTTGAGCACCGCCACCTTCACCTCCATGGTCCGCTCCTTCACCTGCCGCTGGAACCCTCCCATCTCTTCTC
TCTTCTCTTCTTGGTCGGAGAGGATTCCTGTGGCTCGCTGGAGGAGACAAAGAAGACGATGGCGATTGGCGATTTGCCGGGTTGGGTGGCGAAAATGTCG
CCTCGTGCCGAAGTGC
page-top