Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8304  (registered. 2012)
Contig Information
Length 874 bp
Clones alternative view 91 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 9
Wh_e Seed DPA10 2
Wh_h Spike at heading date 1
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 7
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 5
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 5
WH_XA Root 12
WH_XB Root 9
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 7
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|253761550|ref|XP_002489152.1|| hypothetical protein SORBIDRAFT_0016s002240 [Sorghum bicolor]
Score 162
Evalue 4.00E-38
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8304
TTTTTTTTTTGAACAGCCTTCATGTGCTTCAATAATTTTTTGAGCGTCTTCCATAAGCGTTTTGAAGGCCACATATATGCAACAACTGATAGAAATAAAG
TAAGCATATTCGCTGGGTTGCTGGTCTTCTACAGAAATTGAGCCAATACGTTCTAATAAAAAACAAGTACTTAAAACTACCAATGACAATGAGAGGAGAC
AAACACAGGCAACAGAATGATAAAAGGCTACCCCATGGGTAATTAACTCATGTTCAACAATTACATCATTCAGTATCCATCAAAATATAAAGCCACTCTC
AGAGTACTGAGCAATCATTACTGGAATTGAAATTAAGCCTTCTATTAAGAGTTCCATTACTTCATCCCTGATTAGCTTCACTTCAGGGTAGCAGGACCAG
GTGAATTAACGGTACTTGATGAAGCCAATGTCCTTGGCGTTGCTGCGGAAACACTGCCTGCAGCACATCAGCCCATACTTCCTGATCAGTCCATGGGAGT
TTCCACAGACCCGGCAGACGCGGGAGCCGGGCCCGTAGTTCTTGGGGTGGGAGTTCCAGACGTTGGAGTGCCCCATCGTTGCCGCCTTCTTGTTCGCCTT
CCGCCTGCCGCCGCCGGTTGCTAGGATGCGCGCTCGTGCCGATTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACGTCAGTATCGCTTCGAGCCT
CCACCAGAGTTTCCTCTGGCTTCGCCCCGCTCAGGCATAGTTCACCATCTTTCGGGTCCCGACAGGCGTGCTCCAACTCGAACCCTTCACAGAAGATCAG
GGTCGGCCAGCGGTGCGGCCCGTGAGGGCCTCCCGCTCGTCAGCTTCCTTGCGCATCCCAGGTTTCAGAACCCG
page-top