Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8292  (registered. 2012)
Contig Information
Length 2037 bp
Clones alternative view 38 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 3
Wh_VSCB Liquid cultured tissue 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 5
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XA Root 1
WH_XB Root 4
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115478064|ref|NP_001062627.1|| Os09g0132600 [Oryza sativa (japonica cultivar-group)]
Score 342
Evalue 8.00E-92
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8292
CAATACGGCAACAAATAATAAAGCTCTGGCTTCATACGTTAGTCAGCATTGTATTTATTTCAACAAAGAGAGAAAAACAAAGCACTTACCTAAGCTTGCA
GTAGTTCTAGTTCTCAAAACACCATTATGGATGGAGAATATATGCATAAAAGTCCACGAGAACAACATAGGGCAACTCGAGCAGAGCTCGTACTAACTTC
CTACACGGCGCTCTTCTACCAGTGTTCTCTACTGGTAGTTCCTCCCTGGCCCGTCCCTTCCCTCATATGGAGGGGCCGCGTTGTTGTAGTTACCACCACC
TTGGTAGCCTGGGTTACCACCTGGTTGGCCCTGGTAGTCTGGTGCACCACCACCATAGCTAGGACCACCGCCTTGGTAGGGAGGAGGCTGGTTGCCACCT
GCGAAAGGCGGCGGCGGGTTGCCTCCTGGCGCTCCACCCTGGTATCCAGGGTTGTTGCTATGGTAGGCTGGGCCTGGTCCATTGTGCATGTTGCCACCAG
GATTACCCTGGTAACCTTGGTTGCCAGCTGGGTAGCCAGGGGCTGAGGCACCTCGGTATCCAGGGGGTGGTGGTGCATTTGGATAGTTTGGTCCACCTCC
TGCAGCATAGCCTGCCTGTGGGTTTGGTGCATGGGGCTGGTAATTTGGTGGAGCACCTGAAAGCGGCGGCGGGCCCTGTGCACCGCGACTTGGAGGAGCA
GCATCATGGGGTGGCATTTGGTTTGGAGGACCACTCTGGTAGGCCTGTGTGTTCTCCCTTCTCCTTTCAAAGTTCCTCGACCTGTCAAAGTTGCGAGGCC
TGTCATTGCGCCGGGATCTATCATTGGCACGGGCATTGTTTCTCACCCACTCCTCATGGTATTTGGGGTCGTAAGGAACAGCTTGTCCATCTATAAATGG
TTCTCCTCCATAGTCCTTATTTCTGACATCCAGGTATGAATCAGGAAGAACCCAACGGACTTTTGGTGCCCTAGTATCTGAGGAACTCTCCTACAAACTC
AAAGAGTTGCCTAAAGTCCGTTGGGTTCTTCCTGATTCATACCTGGACGTCAGAAATAAGGACTATGGAGGAGAACCATTTATAGATGGACAAGCTGTTC
CTTACGACCCCAAATACCATGAGGAGTGGGTGAGAAACAATGCCCGTGCCAATGAAAGATCCCGGCGCAATGACAGGCCTCGCAACTTTGACAGGTCGAG
GAACTTTGAAAGGAGAAGGGAGAACACACAGGCCTACCAGAGTGGGCCTCCAAACCAAATGCCACCCCATGATGCTGCTCCTCCAAGTCGTGGTGCACAG
GGCCCGCCACCGCCTTCAGGTGCTCCACCAAATTACCAGCCCCATGCACCAAACCCACAGGCAGGCTATGCTGCAGGAGGTGGACCAAACTATCCAAATG
CACCACCACCCCCTGGATACCGAGGTGCCCCAGCCCCTGGCTACCAAGCTGGTAACCAAGGTTACCAGGGTAATCCTGGTGGCAACATGCACAATGGACC
AGGCCCAGCCTACCATAGCAACAACCCTGGATACCAGGGTGGAGCGCCAGGAGGCAACCCGCCGCCACCTTTCGCAGGTGGCAACCAGCCTCCTCCCTAC
CATGGCGGTGGTCCTAGCTATGGTGGTGGTGCACCAGACTACCAGGGCCAACCAGGTGGTAACCCAGGCTACCAAGGTGGCGGTAACTACAGCAACGCCG
CCCCTCCTCCCTATGAGGGCAGGGACGGGCCAGGGAGGAACTACCAGTAGAGAAGACTGGTAGAAGAGCGCTGTGTAGGAAGTTAGTAAGAGCTATGCTC
GAGTCGCCCTATGTTGTTCTCGTGGACTTTTATGCATATATTCTCTATCCATCATGGTGTTTTGAGAACTAGAACTACTGCAAGCTTAGGTAAGAAGTGC
TTTGTTTTTTTCTCTTTGTCGAAATAAATACAATGCTGACTATCGTATGGAACCAGAGCTTTGTTATTTGTTGCCGTATTGTAATAGCAACATGTTCTGT
GTGTTCTATTGAATCACTTTTATATTCAAAAAAAAAA
page-top