Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8268  (registered. 2012)
Contig Information
Length 843 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195649643|gb|ACG44289.1|| hexokinase-2 [Zea mays]
Score 221
Evalue 1.00E-55
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8268
AGCATTCAGACATACATAAATGTATATACTGGAGAAACCAGGCAACATAAAAAGATGGTTAAATTGGATGATGTCGATCCCCATCTTTATTGGAAGGAGA
AAATACAAAAAAAAGGATTAACAAAATGTTATGGATTACAAACACCACCAGACAAGGGGAAAAAGAATCGGCAGAACAGGAATGGCATTGTCCAAACCTC
CATCTCCATATGTTGCTGCCACTCAAACTTTTATGCCATTAGATAAACCTCCAAGCTCTTTGGCGCTATGCTAGCTACATCCCGCTGCAGACGCACCGGA
GAGTGTCCGCAGAATAGCCGAAGAAGGTAAAATTCCACCACCAGGCGATTAGGAAGGTTCGAAGGGAAAAGAAAGAAAAAAAAAGGAAGAGAAGAGGCTG
CTACACTCTGGGTTCAATCCATCCATCGGGCTCGTTACCAAGAAGACTAGTAGATATCAGCGTACTGGGAGTGCGAAGCGGCGAGGAGAGCAGCTCCAAT
GCCAGAGCCGTCATTGGCCAGCTTGGCAACCAGCGAAGAAGAGGCTTCGTCCCCGAGGAGATCTGAAAGAGTTGCCTCTAAGCAGCTGCTGAACTTCTTG
TAGTGCTCATAGAGCCCACCGTCCAAGGCAACCACGGTCCTTGGCATCGGGCTGCCGTCGGTTGGCACCTTGTCCCGGCCTAGCTTCTTCAGGATGCCAT
ATATGCCAGCAGCGGCCAAGCGTGCGCCGCGCTCTGCAACGATGTCACATATGTGACGAGTAATGTATCTTACTTCCAGGGAAGTATCCGCAACCCCAAC
GATATCCTTTAGCTTACTTCCCAGAATTTAAGGTCATGTGATG
page-top