Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8253  (registered. 2012)
Contig Information
Length 1099 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XA Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242050364|ref|XP_002462926.1|| hypothetical protein SORBIDRAFT_02g034580 [Sorghum bicolor]
Score 470
Evalue 1.00E-130
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8253
GTTGGAAAAAGGCCAGATGCCACATACCAAAAGAATCTGGTGATACAAGCATATATAAGCTTGATAAAATGCAAACAACTTTATATAAAAAGAAAGTACT
GATCCTCCTAATCAGTCAGCAGGCTGAGGCTCTTGGTTGGATGGTTTGTACACACTGAAGTCGCCGAAATCCCTTCTTCCACTGTGCTTTATATTCCAAC
CAGAAGGTAGATAACGAGGGTGGACAGCTTCGACGAAAACATGCCTCCATCTTTGGCAAAACTGGTGAACGGCCTCCTCCCCACCATTGGCCAGCAAAAG
CTCGACCACTTGTTTACCGTGGTGCCCGTGTCCTAGCAGTGATATCTTCTTGTCAGCATTTTTGGAAATAGCTTGGCTGGAATTATCACTGCTGACTGGA
TCCTCGTCGAGATGGCCATTTGCCTGAGTTCCGCTGCTTGATCGCTGCATTCCATCTGACCCAAGCTTCTCCGTGTTAGGGTCACAAGTAGAATCATCCA
TACTGACTGACAAACTTGCGCTTCTTTGGCTCACAGTTAAATCTTCTGCCTGGCTATTACACCCAGTCCCGTCAGCATCTTGTTGACCGCTACTCCCGTT
CCCATCTTCTGAAACTTGCTCTGATAAAGTATGCCTATTTTTTGAATCATCTCCCATGTCTTCTAAGATGGCCTTGTTGCTGCTCTTTCTTATAATGTTT
TCAGTCTGAGCTCTAAAAGAATGAGGATACCCTTTTTTCTTTTCAAGTCTCCTTCGCTCATTGGGGCTCATACCTACAAGTAATGCCATCTCCAGGTCTT
CGGAAGTCACGTCCCTACCACCGTAGTATGACTTCACAATCTGCATTAGCTCTTCACATCTTTTCGAAGGCATAGTGGATCCATGCCGCAGAAGGGCCAT
TGCAGCAGTCCTCAGCAGCAAAGGGGACACACCCTTTTCATTCAATTTATCTTCAGATACTGATGCATCGGTTATTAAACTTCTATCACCCGAGTTCACT
ATTTTTTGTACAAAAAGGGGTATTCCCAATTCTTCTGCTAGTCGCCTCTTGTATTTCTCAGCAGCTGAATGAGCAATTTCATGGCAATCCACACAAAGA
page-top