Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8251  (registered. 2012)
Contig Information
Length 800 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|109729545|gb|ABG46237.1|| germin-like protein 5a [Hordeum vulgare subsp. vulgare]
Score 379
Evalue 2.00E-103
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8251
CATGGCGAGGCTTCAGCTTTCCGTCGTGGCGGCCTGCGCCGTCCTCCTCGCGCTCGCCGCCCCCACCCTCGCCGGCGACCCCGACATGCTCCAGGACGTC
TGCGTCGCCGACCTGGCATCCCCGATCAAGATCAACGGGTTCCCATGCAAGGCGAACATCACGGCCGACGACTTCTTCTTCGCCGGACTCAAGAAGGCCG
GCAACACCAACAACCCGGCTGGTTCGGTCGTCACTGCGGCTAACGTGCTGTCATTCCCCGGGGTGAACACGCTCGGCGTGTCCATGGCGCGCATCGACTA
CGCCGTGGGAGGGCAGAACCCGCCACACACCCACCCGCGCGCCACCGAGATCATCTTCGTCACCGAGGGAACCCTGGAGGTGGGATTCATCACCACCGCT
AACAAGCTCTTCACTAAGGTCGTCACCGTCGGAGAGGTGTTCGTCTTCCCGCGAGGGCTCGTGCACTTCCAGCAGAACAGGGGCAACTGCTCTGCCTCCG
TCATCGCCGCCTTCAACAGCCAGCTTCAGGGCACCCAAGCCATCGCCACCACGCTCTTGGCTGCCACACCACCAGTGCCAACCGACGTGCTGGCCAAGGC
CTTCAGGGTTGATAACGAAGACATCGACGCCGTCAAGGCCAGGTTCAACTAGGGAGCCTCTGCCGTCTCGCAACTCTCCATCCATTTCGGAAGAAAAGAA
TCGTTTGTTTGTTACTGAATAAATGGTATTCAAGTCATCAAGTGAGCTGTAGCGTGTAGTTGATTTGTTGTTGTGTATGTTACATTTGTTCATCTTTGAG
page-top