Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8250  (registered. 2012)
Contig Information
Length 1831 bp
Clones alternative view 74 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 6
Wh_f Spike at flowering date 1
Wh_r Root 3
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VSCB Liquid cultured tissue 9
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XT Roots, 18 day old plants were grown hydroponically 6
WH_XA Root 8
WH_XB Root 4
WH_XD Root, treated at 50 microM Al for 6h 10
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1703227|sp|P52894.1|ALA2_HORVU|ALA2_HORVU RecName: Full=Alanine aminotransferase 2; Short=ALAAT-2; AltName:
Score 933
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8250
TTTTTTTTTTCAATTTTTTTTTTGGTGGAAAAGAAATCTCAGTTGCCAATTTGCCATCAAAGGCATCAGACTGGTAATCTGTTTCACAATCTGATATAGT
ATCACACACACACAAGCCATGGATTTCCTTTATTTTGTCTCATCTACAGGATACTGCTCTCAACGGGGGCAAAAACGCCTAGGGAAAATCCATGAGGCTT
GCATGTAATCCAACACATGTTACACCAGTTTAGTCACGGTACTCTGCCATGAACGTCTCATGGAACACCGTGAAGCGGGAGATGATCGCCGGGATCTTCT
CCTCCTGCGGAAGGATCGTGCACCTGAAGTGCCATGTGCCAGGAACCTGTCCAAATCCAGATCCAGGGACAACAACGATTCCAGTTGACTCAAGGAGACG
AAGAGCATAGAATGCATCAGGTGCTTTGTTAGCAGCTTTAGCGGCCTCAATCGCCTTCTGTGGTAGACAGATTTGAGGGAACAGGTACATTGCTCCTTCA
GCCTTGTTGCAAGTAATTCCCTCAAGTTTACTGAATGCAATCTCCAATGCCTTCGCACGACGAGCTAATGATGCAAGGATCCCATCTTTTTCTGCCTTGT
ATGAAGCATATGATTCATCACTTGCCTTTGGTGGGTTCATGACAAGACTAGCAAGGATCTGGCCGGTGATATTGGAACATAGGTTCACTGATGCTATTTT
GTAGATCTGCTCTCTTACTGGAGCACTGAAGCCAGTAATCTCCATGTAACCACCTCTTTTACCACACTCACCATAATATCCCTTAGAAACAGATTGATAT
GATACTAGAGGGAGATCCTCCTCGCCGTATCCCAAGGATCTCACTATCTTCTTGAAAGAGTGGAATTTCTTGTTGTCAGCGTAGATGTTCTCTTGGTATA
CCTCATCAGCCAGAAGAACAAGACCCTCATTTTTGCAGAACTTCACTATGTCATATTGGTTTTCCTCAGCAAGTACCTGTCCAGTAGGATTTCCTGGATT
GATAACCACCAAAGCCCTAACGTCGATGCCTCTTGACCGAGCATCTTCGAGTTGCTTCTTAACATCAGAGATTTCCAAACCCCAGCCTGTCGATTCATTG
AGATAGTATGGGACAAGAGATCCGCCATGAAGAGCTATAGAAGCCGAGTACAAAGGGTACTGAGGAATCGGGACAAGAATGCCATCTTTCTCATTCCTTA
TCAGTAATTGCATCATCAGGTGCACCCCAGGACTTGCTCCGTCTGTAAGAAAAATATCATCAGCATTAGCAGGGAATCCATCTCGTGAAGCGATCCCAGA
AGCAATTGCATCACGAAGTCCTTTTATACCCTGGCTATGACTGTATGCTCCTGTTGCTCTTCCAGGTATCAAGGCAAGAATCTGCTTTGCTCGAGAAATA
GAATCAGCACTGAACAATGTTTTGATTTCCTCTTTTTTCAACAGGTCTGGATGATCACAAAGTGCAAGAACCTCCCTGAAGAATGTAACTGGTTGCTGAC
CAAGAGATTGTGGGTTCCCAATGTTACAATAGAGGATCTCATCAAAAGGTAGAGATCCTGGTTGAGTTTGCAGCTGTTGCTGCAAGCGCTGAGCATGGAT
GACAATCTCTCCACGCACAGCATACTCACATTTTAAAACCTTGGGGTTGAGGTTGTCCACGGCGACGGTGGCAGCCATGGCGAGATCAACTAAGGCGAAG
GGGGGCGGCAGAGCAGCGAGTATATCCTGACGCCTCTAGCTGTCCGTCTCTATCTCTCCGCGGTTTTGTGGCGACTCGGAAGGGAGAAAGGAAGGCGATG
TGCTTATAAAGAAGGGAGGGATCGGGACGAG
page-top