Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8249  (registered. 2012)
Contig Information
Length 745 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_OKCS Seed DPA5 1
WH_XA Root 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222636555|gb|EEE66687.1|| hypothetical protein OsJ_23341 [Oryza sativa Japonica Group]
Score 285
Evalue 5.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8249
TTTTTTTTTTCGAGTACGAGGAAACGTTTTATATCTTAGCTCCAGAACATGTCACACCACATGCAACAGCCACTAGTAGACGTACGCTCGTGCAATGTTT
GGATACAATGACAACTCTGAATTTGGGCGCCAATCAACAATAATCTAAGGATATACAAGGAGACCAATAAAATCACAATCGACTAAGAAAGTTCATGCAT
GATAGTTCACATCGTCACATCAGTATGTGGCTTGAATGCTGGTTCGGGACAGTTCATGCCAGCCATGCACAATACAGGAGAAACTTGAATGCTGGTGCTT
CTGTCCCTCAAGAGTTCTAGCGGACGCTGTCAGGCCTGCTGACGCTTCGCATCGACGGCTTCCTTCAGCTTCCTCCCAAGCGCAAAGGCAAGAGGGGGTG
GCACAGCGTTGCCAATCTGCCTGTGCTTGCTCTGAATGGTGCCCGAAAACTGGTAGCTGTCAGGAAAGCCCTGAGATCGCGCACATTCACGGACCGTGAT
AATCCTGTCCTGGTCAGGATGGAAGCACATGCCAACCTTGCCCATCGGCTGAGGATCAGTCACAGAAGTGGGGAAATTGCCCTCCCAATCTAACCTCCCA
TACAGACCCTTCCACTGATTGTGCCTTTTAGCGGTGTTAGGCAAGCACCAAGGTATCAGGTCCACCATTTGCCCAGAAGATAGCTTCACCTTCTCATCTG
GCAGGTCATGCCAGTCACAACCAGGTCGTTTGGGAATGTGTTTGC
page-top