Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8231  (registered. 2012)
Contig Information
Length 1139 bp
Clones alternative view 197 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 8
Wh_dL Crown of seedling 11
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 3
Wh_r Root 2
Wh_yd Spikelet at late flowering 10
Wh_CSEC Callus 13
Wh_DPA20 Seed DPA20 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 7
Wh_SHC Shoot grown with cold treatment 5
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 2
Wh_VSCB Liquid cultured tissue 11
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 11
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_CA 2
WH_SP 11
WH_XA Root 4
WH_XB Root 10
WH_XC Root, treated at 50 microM Al for 6h 13
WH_XD Root, treated at 50 microM Al for 6h 7
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 20
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|7711024|emb|CAB90214.1|| putative elongation factor 1 beta [Hordeum vulgare subsp. vulgare]
Score 440
Evalue 2.00E-121
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8231
GCAGACAACAGAAGTAGCTCCAATGAAGGTGGCAGACAGAAGAAAATAGCAACAGGAATCAACCACATTGTCTCATTTCATACGAAGCAAATAGCACTCA
GTAGTAATACTACGACCCAACTCAACCTAAGGTCCAAAAACCTCACAGGGCAGAATATGTTATGCTGCTTTAGCTACGGCAACGGAAAACTGTAGATATA
TTGTTTGTGCTGCTGCATTGTCCACCGACCGCCATCACTTGCCTCAGGAAGATTTAGATTTTGTTGAAGGCAACAATGTCACAGCTCTGGATGTACTCGT
TGGCTGGCTCGACGCAGAGATGGTCTTCAATCAGAGTGTCAACAGACACAAGGTCATCAATGATGGTCATCATAATCTGAAGCTTCTTGATGCCATATCC
AACTGGCATGAGCTTGGAAGCGCCCCACAGAAGGCCCTCCATCTTGATGCTTCGGACAGCTTCCTCAAGCTTGACCATGTCAGTCTCATCATCCCATGGC
TTAACATCAAGCAAAACTGACGACTTGCCAGATTCTTTCTTCTTGGTAGAAGCCTTTGCTTTGGCAGCACGCTCTTCAGCTGCCTTCTTCTCCTCTTCGG
TTTCCTCTCCAAAAAGGTCAACATCACTGTCATCGTCATCATCAGCTGCAGGAGCCTCAGCAACATCAGTAGTTGAGGTTTCAGGGACAACTGATGACAG
AACCTTCACACCTTGACCGGCCGCAGTAACCCCGCTCAGCTTCAGGAGCGCATCAATGTGATTGTACCACCTTGCAACATTGGTGCAGGTCGATGGTGGA
GCAACTGAGAACTCAGAATACACAGCCAAGTCATCCTTGGAAGCTTGGTATCCAGAGATGTAACTGCGAGACAGAAGGTAGCCATCAAGCTTTTGAAGGC
CTGCCTCAGCGTTAACATTGAATGTAGCCGCCATCTCGCCTCAAAAGGATGACACAGATGATCTCGAGGGAGGGAGCGAGTCGAGGTGTGGCCGCGGGGA
GGCGAGGAGGAGGAGGAGGACCCTCGTGCCGAATTCGGCACGAGGCGGCGGTAACTAGCATGCGCAGCACACGCGCGTTCATCACCCGATCAACGCCGTC
GAGTGTCCTCATACCCTGCTGCAGCAGCAGTGTCTAAGA
page-top