Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig821  (registered. 2012)
Contig Information
Length 596 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195617904|gb|ACG30782.1|| 60S ribosomal protein L27a-3 [Zea mays]
Score 210
Evalue 8.00E-69
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig821
GATGTTGGTTTACCACACAGGAACCAGGATAACAAACTAACGATGTCTTNNNNNNNCAAATTGCTGGTACGGGAAACAACTAATAGTTCAGATATAATAG
ATCTCAAGGCACGGTCGCGAACAGAACCCTAGGCAACGAGCACGACAGCGCCGCCGGCGGCCTTGATCTTCTTCTCTGCGATCTTGGAGATGAGCTTGGC
CTTGACGACGATGGGCTTCTCCGGCAGCATCCCCTTGCCGAGCACCTTGAAGTAGGAACTGCGAGACGTCGACCACGGGGGCCTTGTCGCCGCCGGCCTC
GGCCGCCTTCTCGGACGGCACCATGGACCAGAGCCTCTCGACGTTGACCGTCGGGGTGTAGAACCTGTTGCTGAGCTTGTGGAAGTAGCGCATACCGACC
TTGCCGAAGTAGCCGGGATGGTACTTGTCGAAGAGGATGCGGTGGTGGTGCATGCCTCCGGCGTTACCGCGGCCTCCGGGATGCTTGCGGTGCTTGCCCA
CACGCCCGTGCCCGGCGGACACGTGGCCGCGCTTCTTCCGGTTCTTCTTGAAGCGGGTCGTCATCGCCGCCGCTCGCTCGCCGCCGCCGCGGGCTT
page-top