Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8193  (registered. 2012)
Contig Information
Length 1462 bp
Clones alternative view 50 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_RDr Root of dessiccated seed 1
Wh_VSCB Liquid cultured tissue 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 23
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23℃ 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115336282|gb|ABI94363.1|| fructose-1,6-bisphosphatase 2 [Oryza sativa Japonica Group]"
Score 648
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8193
TTTTTTTTTTGGTCAAAACCCAATCGATCACTTGTTAGAATTGTTCCCCTCTCTTGGAGTACTTCCTCTGTAAAGAAGTATAAAATCGTTTAGAATACTA
TCTTATATTTAGTATTCTAAACGATCTTATATTTCTTTACAGGGGATACTTATTAAAATGACGTGCAATATGTCAAATATATGTATACACAGGTATTGTT
ACATCGAGGCCATGACAAAGATCTCAGAATCACCATGTAACACTACCTAGGGAGTTTTGTCACAACGCGGAACACGATGCAGAGCATGTGTATGTGTCTT
CGGGTACTCAGATCAGGCGGTGCTCGACTCCGAAGCGTACAGTGATTTAATCTCCTCCACATCATCGTAGCTCCCGAGGAATATCGGAGACCTCTGGTGT
ATCTCAGCAGGAACGATTTCAAGGGCACGCTGTTTGCCGGTGAAAGACTGGCCTCCGGCTTGCTCCATCAGGAACGACATGGGGAAAACCTCGTACAGAA
CACGAAGCTTCCCGTTGGGGCTCTTCTTGTCGGCGGGGTACAGAAATATGCCTCCGTAGAGCAGGGTACGATGAACATCGGCAACCATGCTTCCAATGTA
TCTCAAGGATTTTGGTGATGAGCCGTCTTGGGGAAACTTGCATCTCTCCACGTACTTTGCTGTGGGCGCGTCCCAGTTTCTGGCGTTCCCTTCATTGACC
GAATAGATCTTCCCTTTGTTTGGTATCTTTATGTTGGGATGGGTAAGTATGAACTCCCCAAGGGAAGGATCAAGAGTGAAGCCATTAACACCGTTCCCGG
TGCTCAACACAAGCGTGCATGAGCTCCCGTACATGCAGTAGCCAGCGGCGATCATGTCAGTCCCGGGTTGCAGCACGTCCTCCAGAGTCGCGTTGTCCTT
GTCTTTGATCATGTAGATCCCAAAGATCGTCCCGATGGAGACGCCGCAGTCGATGTTGGAGGAGCCGTCCAGCGGATCGAAGCACACGCAGTACTTCCCG
CGGAGGGGCGCGTCGACGAAGATGGCCGCCTCGTTCTCTTCAGACACGAGGACACAGGTGCGGCCGCTGCTGACGAGCGCCTTGACAAAGACCTCGTTGG
AGAGCACGTCCAGCTTCTTCTGCTCCTCCCCCTGGACGTTGGTCTCGCCGGCGAGGCCGATGAGCTTGGCGAGGCCGGCCTTGTTGACGGCGGAGGCGAC
GAACTTGCAGCCGAGGACGATGTGGGAGAGGAGGATGGTGAAGTCGCCCCGGGACTCCGGGTGCCGCCCCTGCTCGTTCAGCGCGTGCCGCGTGATCGTC
ATCAGGTCCGTCCGCTGCGCCTCCGCCGCGTGGTCCATCCTCTCTTCTCTACTCCGCCTCTGCGACCGGCGCGTGATCTCCGCCGAGCAACGGCGCTAGC
TCTTCTCGGTCGTCGGGAGCGACCGACGGATACAAACAGATTGCACCGCCCACGGATGGTTG
page-top