Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8187  (registered. 2012)
Contig Information
Length 1984 bp
Clones alternative view 10 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_DPA20 Seed DPA20 2
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_XV Leaves, plant was grown at constant 23℃ 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218189050|gb|EEC71477.1|| hypothetical protein OsI_03737 [Oryza sativa Indica Group]
Score 818
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8187
ATAGGGATGTGTCTAGTGTGGAGAAGAGTGCCTACTATACGATCGCGGAATGTGTGGTAGTGACCGCAGTAAGGGATGGGATGAACTTGACACCATATGA
ATACATCGTCTGTAGGCAGGGGACACCTAGGTCTGAGTCCTCATCGGAGGTGACTGGGCCAAAGAAGAGCATGCTCGTGGTTTCAGAGTTCATTGGGTGC
TCACCGTCTTTGAGTGGTGCTATTCGGGTTAACCCATGGAATGTAGAGGCAACTGCAGAGGCGATGAATGAGGCCATTTCAATGTCTGATCAGGAGAAGC
AGCTGAGGCACGAGAAGCACTACCGTTATGTCAGCACCCATGATGTTGCTTATTGGTCGAAGAGCTTCATCCAGGACTTGGAGAGGGCTTGCAAGGACCA
TTTTAGAAGGACATGCTGGGGCATTGGATTGGGATTTGGTTTCAGGGTGGTGGCCTTAGACCCTCATTTCACAAAGCTTAACATGGATTCTATTGTTATG
GCTTACGAGAGGTCAGAGAGCAGAGCTATATTTCTTGACTATGATGGAACATTGGTGCCTCAGACTTCCATCAACAAGACACCTAGTTCAGAAGTTCTGA
GGATTATCAATACCCTCTGCTCAGATAAGAGGAATATAGTTTTTATTGTCAGCGGGAGAGGCAGGGATAAATTGGGCGAATGGTTTTCCTCGTGTCCGAA
GCTGGGTATTGCAGCTGAACATGGCTACTTCTTAAGGTGGAGTAGAGATGAAGAGTGGCAAACGTGCGCCCAGGCTTCGGACTTTGGATGGATGGAAATG
GCTGAACCAGTGATGAATTTGTATACAGAATCAACTGATGGATCCTACATTGAGACCAAGGAAAGTGCTTTGGTGTGGCACCATCAGGATGCTGACCCAG
GCTTTGGATCCTCACAGGCCAAAGAGATGCTTGATCATCTGGAGAGTGTACTGGCAAATGAACCAGTCTCTGTCAAGAGTGGCCAGTTTATTGTTGAAGT
CAAACCTCAGGGAGTAAGCAAGGGAGTAATAGCTGAAAAGATACTGATATCAATGAAAGAGAGAGGAAAGCACGCCGACTTTGTATTGTGTATTGGTGAT
GACAGGTCTGACGAAGACATGTTTGAAAACATTGCGGACATAATCAAAAGGGGTATGGTTGCCCCCAAAACACCATTGTTTGCATGCACTGTGGGACAAA
AACCAAGCAAAGCAAAATTCTACCTGGATGATACGTTTGAAGTGGCCACCATGCTGAGCGCACTGGCGGAGGCAACAGATCCTGAACCTATGACCGGCTC
CACCGATGAGTTAGCTACGGCTATGTCCTCAATTGATATTGGTGGTGAACGAAGTCAGTCAAGGGGTAGACCTTTCGATGGATTGTAGTTCAGATCTTGG
TTAAATCTGCAGATTATGGCGATTGATTCAACAGTCGCTTCTACACATATATTCTGACAGATATGAAGATGGGTACTCAATGAACGACTAACACCAGGGC
CTACAATTTGAAGCTAGTGCAGAAGCATGCTCGATTATCCAGCCGGGCAACACATTACCATCTTTTGCTGCAAAATGCAGGTCCATATGTCAATAGCTGA
CTCGTCACCTCTCTTTGCATCTTTCTCTTAAACCTTTTTCCTTCTCTAGTAAAACGAGATGCCTCATGGAAGGCAAGTGAACTGTATGGACGAGGTGATA
GGCACTTTGGGATGATAGGATTGGCACTGCACATGGAAATTCAATGGAGTGCATCCTCCTCTGCGTGTGATCCCGTGTAAACAAGTTACACATCGGTTTC
AGTTTTGTTTTTGAAGTCTAAAGTCGCGTAGTAAATGTGAATGGTGAGATTTGGTTCGTCATTTGAAACCTTTTTGTTTTTTGCTAGCCTTGCTCTCATA
GCTTTGCTCCATAATTTCTCCCTCCTTTGTTGGGTTCAAGTATGCTTCTATCTGAAAACAGCATGTAGGATTCTAAAAAAAAAA
page-top