Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8184  (registered. 2012)
Contig Information
Length 918 bp
Clones alternative view 25 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_VSCB Liquid cultured tissue 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 5
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 5
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|116308887|emb|CAH66021.1|| OSIGBa0105N24.5 [Oryza sativa (indica cultivar-group)]
Score 271
Evalue 1.00E-70
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8184
TTATTATGACTAATAAGAAATTATTAAAACACAAAGCATCTGTGCATTTTCCCCACCAAATAAAAAAACATCTCCGCATTTAGGGATCAATGAAGGACAC
GCTCGAAATCAACGGCAGCCAAGAATGTATCCTTTGATCCTGAATGGAGACAAGCAGTTTTCTTCTGTAGCAAAACACAAGACTACCATACCAAGGCATA
AAACCCACCGCGATAAAACCGAAAAACAGAACTGAGCAAGACGGCTTAAAACTCCTACATATCGAATTCTGCAGGTCCCCAGCTCACGAATCCTATGGGC
AAAAAGCGGGACATGTACTGCTCCAAAAGTATGCGTAAAACACGACGAGTTTCCATATTGATAGCTTCCCCTCCTATCACAATCCCCTTACTGGCTTCAG
GTTGTCTTAGCCTTTGCGGTCCTTCTCTTGGAGTGCCTCCTTGGGATGGAGTTCTTCATTCCCAGGAAGAAGAGCAGCGCGCCGAAGAGGGCCAGGTTCT
GTGAAAACATGGTGAAGAGCTTGGCAAATTGCTGGGACTCCATCTCGTAGTTGTAGAAGTCGTACACGACAGGGGTTATGAATGCCAAGTAAACAAGCAG
TACGAGCGCTCCGAACGAGCTGCTGATGATGAAAAGGAGACCACCAAAGGCTTTAAGAAACATGGTAAAGGCAATGACAGACTTGATGTCAATGTGTGGC
ACCGCCATCCCAATGCCGGCGGACACCTGCTTGACAAACAGGTTGAACTTGGGCTTCAGAGACTTTGCTGCTGGTCCTCCATCCGTTCCAAACTCACTGA
ACTCTTGGTAGGCGGAGAGGAGGAAGACGGAGGCGAAGAGCACCCTCCCGACGAAGGAGACGAACCCCATCGCTGCTGGCCCTGCCCCGACTCGCCGCCG
CCGATGCTGCTGTCCCGC
page-top