Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig818  (registered. 2012)
Contig Information
Length 842 bp
Clones alternative view 34 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 2
Wh_r Root 1
Wh_yd Spikelet at late flowering 3
Wh_DPA20 Seed DPA20 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 5
WH_XA Root 3
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226316441|gb|ACO44684.1|| fructose-bisphosphate aldolase [Triticum aestivum]
Score 466
Evalue 1.00E-129
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig818
CTTGGCCTCTTTATAACCCCCACCCTCTAATNNNCCCCGTCCACCAAAGCCTTCAGCCTCCCTCCCTCCCTCCCCTGCCAACCCCAAATCTCCCCTCGCC
CGTCGCAGCTCTCGAATCCCCCCCGAGCATCGACCATGTCGGCCTACTGCGGAAAGTACAAGGATGAGCTCATCAAGAACGCTGCCTACATCGGCACCCC
TGGCAAGGGTATCCTCGCTGCTGATGAGTCCACCGGCACCATCGGCAAGCGCTTTGCCAGCATCAATGTTGAGAACGTTGAGGACAACCGTCGTGCCCTC
CGTGAGCTCCTCTTCTGCACCCCTGGTGCCCTCCAGTACCTCAGCGGCGTGATCCTGTTTGAGGAGACCCTGTACCAGAGCACCAAGGGTGGCAAGCCCT
TCGTCGACATCCTCAAGGCGGGCAATGTCCTCCCTGGCATCAAGGTGGACAAGGGTACCATTGAGCTTGCTGGAACCAACGGTGAGACCACCACCCAGGG
CTTTGATGACCTTGGCAAGCGCTGCGCCAAGTACTATGAGGCTGGTGCCCGCTTCGCCAAGTGGCGTGCAGTCCTCAAGATCGGCGCCACTGAGCCATCG
CAGCTCTCCATCGACCAGAACGCTCAGGGTCTGGCTCGCTATGCCATCATCTGCCAGGAGAATGGTCTGGTGCCCATTGTGGAGCCTGAGATCCTTGTTG
ATGGACCTCATGACATTGACCGCTGTGCTTACGTCACCGAGATCGTCCTTGCTGCCTGCTACAAGGCCCTCAACGACCAGCATGTCCTCCTCGANNGCAC
TCTCCTGAAGCCCAACATGGTCACCCCTGGTTCTGACTCCAA
page-top