Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2794  (registered. 2007)
Contig Information
Length 838 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein BAD_0487 [Bifidobacterium adolescentis ATCC 15703] >gi|118765089|dbj|BAF39268.1| hypothetical protein [Bifidobacterium adolescentis ATCC 15703]
Score 85
Evalue 1.50584
Total Hit Count 3
Registered year 2007
Contig Sequence     [ Download ]
>Contig2794
ggctccttctctcccgacgcccctcccgttgaatacagcgtgagctctgccctgttgatgtccgatccagcgccgccgatttctccatggagtgcatggg
gttctatcctaggtcgctcgccggtcacgggctctccctgCCCTGTGCGACTCCTCCGCAGTGTGGTCATCCTCCCGCGCGAGCGCGGGTGTGCCGCCGT
CGTCGAGATGAACCGCGCCGCCTTCGGTCGCTGCCGCAGCAGGTATGCATTAGGAGCGGGCGCCTCTTTTTACCACGGGAATCAAATGCTGCTGGCCCCT
GATCTGGATGACCAGACCTGCAGCCAACTCTTGATATGGAAGCATGAATAGTGCAGGAGCTAGCAAAGCTGCCGCTCGCCGTATGGAACACCAGTACCAC
CGTGGGAAGGTGGAAGCACAAATAGAAGCTGCTCTTTCTTCCTGGCCGAGTATGGATCAAGCGTCTCGGTCATTAGCTTGGCAGCTATGCAACATGCCGT
CTCGCCAGCACAACTTCAACCCATCTGCACAGGTTCAGCGACGCCCCCCTTCCCATGTCCTCTCGATGGCAGGATTACCTCGATCTCTGGTGCAGCCGTG
GCGTTCTGGTTCTTCTTTCTCGCTTGcagaagataagctttctaagcacaagactcttcagcttactgaaaactttcttacccacaaaacttcttgctga
tatctaaaaacgaactgataggacaacttcataatcttacacgtttatagcttaggacctgctatttgtctcacttcattcatctgcatgtgagttgcat
ttgggtctcctagagccaattaanaagcataggctttc
page-top