Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2792  (registered. 2007)
Contig Information
Length 249 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0528200 [Oryza sativa (japonica cultivar-group)] >gi|113564945|dbj|BAF15288.1| Os04g0528200 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 159
Evalue 1.10374e-09
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>Contig2792
gggtGCAAACAGCGCCGCCCATGCACTAGCTAAACTAGCGACTAGGCCTGCAACCTAATGGTGCCCATGCTTTAATGTAATGTGGGAGTATGACTATGGT
GGTGTTTGGTTCTCTAGTCCTAGGATTTTTTCTAGTCTCAACTAAAAAGTTTTCCTAGTCCCTTGCTAGAGGTTATTAAatgatCATGTTGCCCCTAGTC
tactaccctataaaaggaagagagagcggagaaccaaacaaaaaaaaaa
page-top