Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8161  (registered. 2012)
Contig Information
Length 678 bp
Clones alternative view 89 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 11
Wh_dL Crown of seedling 6
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 5
Wh_yd Spikelet at late flowering 4
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHC Shoot grown with cold treatment 7
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 10
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 7
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_CA 1
WH_SP 3
WH_XA Root 2
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 4
WH_XE Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|110816408|sp|Q5I7K9.2|RL30_WHEAT|RL30_WHEAT RecName: Full=60S ribosomal protein L30
Score 223
Evalue 1.00E-56
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8161
TTTTTTTTTTAACGAGCAACAGTATAACCAAGATTGAAACAACGATATCATGAAAACAAAACCACATGAATGTCCAGCGGAACAACCATATGAAGTATTA
TCTGTATGACAGCTCCAACTCAGCGTCGCAAAAAGGTACACAAACCGAAGATAACAAGAGTGGTTTCGAGAGCACAACAGGACCCTACAACTCGACTAAA
TAAAATAGGTGGAGAGCTCTCTTCTCTTCTCTTCACTGGGTGGTGGTGGTGGTGCTGATGATGTCCGAGTCACCAGGGTCGAGGATGCTGAGGCAGCACA
CCCGGTAGTACTTGCCGCAGGCAGTTCCAAGATCAACATTGTTTCCATGGAAATGGTGCACGCTAATTTTCGCCAACATAGCGTAGTACTCAATCTCTGA
CTTCCTAAGGGGAGGGCAGTTGTTTGCGAGGATTATCAGCTTCCCCTTGGAGCTGCGGAGCGTCTTGAGGACGGTCTTGTAGCCGAGCGTGTACTTGCCG
CTCTTCATCACCAGCTGCAGCTTGTTGTTGATGTTCTCCCCGCTCTTCTTCGCCTTCTTGGTGGGAGCCATCGCGTCGGGCGAGCGAGCGAGCGTGGGGA
TGCGGATGGCTTCGGGGGAGGCGGCCACCGTTCCCCTCCAAATCCACCCGATCCAATCTGCCCGCTCGCAGCTCCAAG
page-top