Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8139  (registered. 2012)
Contig Information
Length 1137 bp
Clones alternative view 23 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_r Root 1
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_VSCB Liquid cultured tissue 8
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115479021|ref|NP_001063104.1|| Os09g0397300 [Oryza sativa (japonica cultivar-group)]
Score 438
Evalue 5.00E-121
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8139
TTTTTTTTTTGGAAATTTAGTCGGTAATTTAACCAAGTTCAACGGAGTCTATATACACAATGGGCGAAACAGGCAGAACAACAACCAAGCAGAAACACAA
CTATGGTGCCGTTTACGACGGCACGGTCCATTATGCTGTCTTATTCAGGCCGGAGGCTGCGCTGCTGCTGGTCTTCTCTGCCAGCTTCCCCCCTCAGTCC
AGCCAGGTGTCGTCGCTGCTGGTGCCGTCGCCGGCAAGGAAAGGGTAAGGAGGGTCTTCGCCCTCCTCCAGCTCTTCGCCCTCCTCCAGCGCCAGCTCCT
GGTCAGAGACGCTCGCGAGGGCCCGGATCATGCGCTTGATGTCGGCGGGTTCGTCCAGGTAGTACTTGGCCTTGCTGGGCTTTTGGCCAATGGTGCAGGC
GAAGACCGTCGCGGAAGGGCTCAGGTAGGGGCCGTCCACCGCGGTGGTGATCACCTCGAACATGTCCTCGTCGGAGCGGTCATCCCCGACGCAGAGGATG
AAGTCAGGCTGGAGCCCCAGCTCCTGCATTGTCGACAGCATCCGCTTCGCCACCAGGCCCTTGCTCACACCCTGTGGCTTCACCTCAACATAGTTCAGGT
CAGCTTTGACTGATACCGGCTCGTTGGAGAGGACACTCTCCAGGTGATCATGGAGCTCCTTGGCCTGGCAAGATCCAAAATCACGGTCGGCGTCCTTGTA
GCACCACACGATTGCTGTCTCCTTGTCCTCGATGATCGACCCGTCCGTTGTCTCGGTGTAGGTCTTCATCACCGGCTCCGCGATTTGCTTCCAGCTGAAG
TCTGTTGCCGGGCCGCATGTCTCCCATTCTGCATCTCTTTCCAGCCTGATGAAGTAGCCATGCTCAGCAGCAAGGCCTAGGTCCTCACATGCTGAGAACC
ATTCACTTAAGGTCGCCCGGGTCTTTGTGCTTGCGATTAGGACCAAGTTCTTCTCATCGCGACAGAGGCTGTTCAACATGTTTATTGTTTTGGAGCTCGG
CATCTTACGAAACGATGACTCAGGCATGAGCGTACCATCATAGTCCAAGAGAATGGCACGCGTGCTTGCCTTCCGGTAGGCTGAGATGAGCTGCTCAGCC
GCGAGCTTCTTGAAGCTCGTATCAAGGGCCACAACCC
page-top