Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8133  (registered. 2012)
Contig Information
Length 872 bp
Clones alternative view 25 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
Wh_VSCB Liquid cultured tissue 12
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 8
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|119388719|gb|ABL74256.1|| alcohol dehydrogenase ADH2B [Triticum aestivum]
Score 466
Evalue 1.00E-129
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8133
AATGAAAACATGCACACAACTTTTTCTCAAGCGGGGCCACAGGGTGGCGCCCCAAAGACCAAACCGTGAGCACAAAACACATACATGTTCGTTCTTACGA
CTATACATTATTACTCGAGGGAAGTCCTTATAATTTTCTTCTTCTTCTGTTTAAAGCAGCGAGGGTGTGACGAAGAAGCTCGATCTACTCGTCCATCCTC
ATGACGCAGCGAAGTCCCTCTCCCTTGAGCATGAGGTCGAACGCCGTGTTGATCTGCGAGAAAGGCACGCTGTGTGTGATGAACTTCTCCACGTCCAGCT
CCTTTCTCATGTACATCTCCACGACTTCCGGGAGGTCGGTACGCGGCTTGTAGTTGCCGAAAAAGGTGCCCTTCAGGGTCCTCTCATTGAGGAAGTTCAT
CGGGTGGGTCTTGAACACTGCCTCCTTATGGGGGACACCCACCAGCACCGCCACGCCCCACCCATCGTGAACGCATTCGAAGGCGGATACCATGGCATCG
ACGTGACCCGTGCACTCCACGGCTCTGTCGACTCCACCGTTTGTCATCTCTACAAGCACCTCTTGCACTGGCTTGGTGTGGTCCTTTGGGTTTACAAAGT
CGGTGCAGCCAAACTTCTTAGCTTGTTCGTATTTTGCAGGGTTCAAGTCCACACCGATGATCCTTGATGCCCCAGCCATCTTGGCCCCTTCCATGGCAGC
AAGGCCTACAGCTCCAAGACCGAAAATTGCCACCGTCGAACCCTTCTTCGGTTTTGCGACATTGAGAGTCGCACCAAGACCAGTCGAGATACCACAGCTG
AGAACACAAACTTTGTCGAGGGGTGCCTCGGGGTTGATCTTCGCTAGGCACCCAACATGGATCACTGTGTAC
page-top