Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8109  (registered. 2012)
Contig Information
Length 877 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|2586127|gb|AAB82766.1|| b-keto acyl reductase [Hordeum vulgare subsp. vulgare]
Score 489
Evalue 2.00E-136
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8109
GGCCTCCGGCCTCGGCCTCGTGCTCGTCGGCCGCAACCCGGACAAGCTCGCCGCTGTCTCCGAGGAGATCAGGGCCAAGTACCCCAAGACCGAGGTCCGC
ACCTTCGTGCTCGACTTCGCCTCCGAGGGGCTCGCCGCCGGGGTGGAGGCGCTCAAGGACTCCATCCGGGGCCTCGACGTCGGCGTGCTCGTCAACAACG
CCGGGGTCTCGTACCCGTACGCCCGCTACTTCCACGAGGTGGACGAGGAGCTCATGCGGAGCCTCATCCGGGTCAACGTCGAGGGCGTAACGCGGGTCAC
CCACGCCGTGCTCCCGGGCATGGTCGACAGGAAGCGTGGCGCAATCGTCAACATCGGCTCCGGTGCTGCCTCCGTCGTGCCGTCCGATCCACTCTACTCC
GTCTACGCCGCCACCAAAGCGTACGTCGACCAGTTCTCAAGATGCCTCTATGTTGAGTACAAGGGCAAGGGCATCGATGTGCAATGCCAGGTGCCCTTGT
ACGTGGCGACAAAGATGGCATCAATCAGGAGATCCTCCTTCCTTGTGCCATCCGCGGACACCTATGCTCGTGCTGCTATTCGCCACATTGGCTATGAGCC
GAGGTGCACACCGTACTGGCCACACTCTGTTTTGTGGTTCTTGATTTCCCTCCTCCCAGAGTCGCTCGTGGACAGTACGCGCCTCAGCATGTGCATCAAA
ATCCGCAAGAAGGGGCAGGCTAAGGATGCCAAGAAGAAAGCGCAGTGATGGTTCCGATGCTTGTTGATTGTTGAGATCTGCCAATGTTTCTTCATCATGT
GTAATGGACTAGTACTTGTAGCTTTGTTGTCGGCATTTCAGTATCATTACCTCCCATCACACTAGGTTGGGACTGTT
page-top