Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2153  (registered. 2007)
Contig Information
Length 622 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100216883 [Zea mays] >gi|194696868|gb|ACF82518.1| unknown [Zea mays] >gi|195648274|gb|ACG43605.1| monoglyceride lipase [Zea mays]
Score 577
Evalue 7.29467e-58
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig2153
tcggcacgaggcgctcgctcgcttgcgttcctgtctcgcaaaaattcaacATTTCTCtcggcTCTTTAattttcccgTGGctggcTGCTTCCTTCCTGCG
ACCGAgttccaGTCGTCGGAGAAGAAGAGAAGGGGTCGAtgacgAGCAAGTCCGGCAGcgccgtGGCGGACGATGGCAGCTACGAGTACGAGGAGGAGtc
cgtGCAgaactcccgcgggctgAAGCTCTTCACCTGCAGATGGCTCCCCCCCAAGGGCcaaatAGTCAAGgcccacgTCTTCCTCTGCCATGGGTACGCG
GTGGAGTGCAGCGTGACGATGCGGGGGACGGGGGTGCGGCTGGCGCAGGCCGGGTACgcggtGTACGGGGTGGACTACGAGGGCCACGGCAAGTCGGAGG
GGCTCCAGGGCTACatcccctccttcgaCCTCctagtCAGCGACaccgaCGCCTTCTTCACCGCCGTCGTCGCCTCCaccgcCAACACGGACCTCCCCCG
CTTCATCCTCGGCGAGTCCATGGGCGGCGCCGTGGCGCTGCTCctccaccggatgcgcccggcgtactggaccggcgccgtcctggtcgcccccatgtgc
aagatcgctgacgagatgcggc
page-top