Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig2065  (registered. 2007)
Contig Information
Length 567 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_oh Pistil at heading date 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 487
Evalue 1.57164e-47
Total Hit Count 405
Registered year 2007
Contig Sequence     [ Download ]
>Contig2065
tccacagcgttggtgcggcgttgcctccccagtcagtccgcctctccccctctgtctctctcgtgttgtttaTTCTTGCGCCCCGACACGGCAGGAGGAG
GAGGAGAGCACCGAGGTTGAGTTCCTTGCCGCCGTTCCGTGGGTGATTCTCGGAGCCCGAGTTGCCGAGGTGCGGGTCCGGTTCGTCTTCTCCCTGGGGC
CTCTTCTCCAGGTTGAGCCACAGTAAGTTGAAGACATCATgttccgtaggaagcacgcttctcatttcaattcagatgatgctgagcagcgacaagcaaa
gatcaacgaactgagagctgcacttgggtctatgtctgcccgtggcgagaagtactgcagtgaagcatgcttggcaaggtatctcgaagcacgcaactgg
aatattgacaagtctaggaaaatgttggaagaaagtctcaagtggagggcagttagcaggcctgaggacattcgctggcctgatgtttctgtggaagcag
aaacaggtaaaatgtacagggcaactttcaccgatagagaagggagaactgtcgttattatgagacc
page-top