Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8086  (registered. 2012)
Contig Information
Length 824 bp
Clones alternative view 67 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 4
Wh_r Root 2
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 5
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 4
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 6
Wh_VWD Shoot grown with dessication 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 6
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 6
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195605420|gb|ACG24540.1|| DNA-directed RNA polymerases I, II, and III 14.4 kDa polypeptide"
Score 277
Evalue 9.00E-73
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8086
TTTTTTTTTTGAGATAGAAATGCGAACACTGAATAATCAGCAGAACGTCCTGCACCACGCTCACAAAAGGAGGTTAGAGTAGGGTATTCATTCGCAACTT
GTAGCTGCATGCAAGCAATGGTCCAAGCAAACTAACGCAACCACGCAATTGGTTTACAGTAGTAGCACAACACAATGGGCAGACATAGCCCACACATGTT
ACGGTAACATAACATTGTCGCGGCAGTTCAGTGCCAAAGATTGCATATAGCTACTAGGGCAAAGTTTAGTTGCAGCACGGAGCCTCCCATTCGAACAGTC
TACCAGCTCTAGTCCCCGCCAACCTGACGCTTCCACGAGTCCTCCACAATGAGCTCGTCAACTCCCCAGTCCTCGTAGCTTCCATCAGGTAAGTAGCGCC
TAATCGTGAAGGGGATCTTACGTGCTCTCAGTTCTTTCATGGCAATCTCAAGAGGATCAGTTTCACCCTCAAGCTCAACCATAACTGGGGCATTCATGCT
TATCTGCAAAGCACGTGTGCCAAGGATGCGTGCCCGCTCATACTTGGTCATATATTTTGTTGTATTGCGTGGACGGGCAGTCTTTTCCTGTTCCTTTTCT
TCACCTTCACCCCCTACCACGTCATCAGGGGCATCCTCGTTGTTCTCAGGATCTTCTTCAACCCCTTCCTCAATATCAGCCTCTGGAGGCTCATCCTCGT
ACCCCATGTCAACTTCATTATAGTCGTCGTCCGCCATGGCTGCCGCCGCCGAGCGCTCCGGTCGCTAGGGTTTCGCCGCGGGAGGAAGCCTCGGGCGTGG
GGATTGTGGCCTCGTGCCTCGTGC
page-top