Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8080  (registered. 2012)
Contig Information
Length 751 bp
Clones alternative view 39 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 7
Wh_f Spike at flowering date 1
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 4
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XB Root 7
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115473643|ref|NP_001060420.1|| Os07g0640100 [Oryza sativa (japonica cultivar-group)]
Score 236
Evalue 1.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8080
TACGCATGATTTTTTTTTCCACATCGATCTTGCCTCTGCAAGACATCAATCCTTCAACATGAGCTTGGGAAGCAGGGTCTATGAGTTACAACCGTTTCAC
TGGCAGACACCATCTCATTGAGTAGAGATGACCAAGTAATCAAATCAAGCTCGAACAAAGCAAAACATAGAGTAATAAAATAAATTGGGCCGGATGTGTT
TCTCAGCGTCTTATTCAGAGTACATGTCAAGGGCACTTCTACAGGAAGGCTGGAAATTTTTGTGGCGGCCTCGGATCCTAGTAGTTGCTGGTGTAGAATT
TCTTCAGGAACTCGGAGCTCCCTTGGTCCTTTTCCAGGTCCTGCACCAGCCCCTTGTGGCCAACCACATATTGCCCGATGATGTGGTGGCGCTGCTTCGC
GTGCTCGGTGATGTTGTTCAGCTCCTCCATCCCGTTGAAGAGAAGCATATCAATGACCTTGGGGTCGGAGACGCCCTGGTTCTTCCGGATCTGCTGGGAG
ATGCTGGCGCGGAGCTGGGCGGGGGTCACGACGTCGTCGAGGTTGTAGATCTCCATGATGGAGGGGATGGCGCGGCAGGCCTCCCTGAAGAAGTCGAACA
CGCGGTGCCGCGCCTCCCCCATCGACGCCGAGTTCGGCGGAACCTTCACGGCGCGCATGGTGAACGCCATCTCTTCGCCCTGACCCCGCTTCGCCGCCTA
TCTCCGGCCGCCACCCTCTCGCTCGCCGCCCGTCCTCAGGTGGCTCCTCCG
page-top