Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8065  (registered. 2012)
Contig Information
Length 655 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 6
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 5
WH_SP 4
WH_XA Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|170059756|ref|XP_001865500.1|| histone H3.3 type 2 [Culex quinquefasciatus]
Score 263
Evalue 1.00E-68
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8065
TTTTTTTTTTAGAACAGATAACAAACATTTTCATTTCAGTTACTGATGACAGCAAGGAGGTGACATCAGATCAGGAACACTACATCCACCATGGCACGAA
CAGACACTACAAACACGCACAATTTCACCGCTGAACACATCTGGCTAAGACGACGACTAACAGACGACGACGCACAGAGCTTAGGCCCTCTCTCCACGGA
TGCGGCGGGCGAGCTGGATGTCCTTGGGCATGATGGTGACGCGCTTGGCGTGGATGGCGCAGAGGTTGGTGTCCTCGAAGAGCCCCACGAGGTAGGACTC
GGCGGCCTCCTGCAGGGCGGAGACGGCGGAGGACTGGAAGCGGAGGTCGGTCTTGAAGTCCTGGGCGATCTCCCTCACCAGGCGCTGGAAGGGTAGCTTG
CGGATGAGCAGCTCGGTGCTCTTCTGGTACTTGCGGATCTCCCGGAGCGCGACGGTGCCGGGGCGGAAGCGGTGGGGCTTCTTGACGCCGCCGGTGGCCG
GGGCGGACTTGCGGGCCGCCTTGGTGGCCAGCTGCTTCCTCGGCGCCTTGCCGCCGGTGGACTTCCTCGCCGTCTGCTTGGTACGGGCCATGGAGTCGGA
GATGCGCCGGGAGGTTGTTGAGGAGGGGGGAGCGCTGGGAGGGTTGGCCTCGTGC
page-top