Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1775  (registered. 2007)
Contig Information
Length 682 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein Bm1_17870 [Brugia malayi] >gi|158598170|gb|EDP36122.1| hypothetical protein Bm1_17870 [Brugia malayi]
Score 231
Evalue 1.19303e-17
Total Hit Count 12
Registered year 2007
Contig Sequence     [ Download ]
>Contig1775
gcatgtgcaagtatgaaccaatttgaactgtgaaactgcgaatggctcattaaatcagttatagtttgtttgatggtacgtgctactcggataaccgtag
taattctagagctaatacgtGCAACAAACCCcgacttctgggagGGGCGCATTTATTAGATAAAaggctgacgcGGGCTCTGCTCGCTGATCCGatgatT
CATGATAACTcgacgGATCGCACGGCCTTCGTGCCGGCGACGCATCATTCAAATTTCTGCCCTATCAACTTTCGATGGTAGGATAGGGGCCTACCATGGT
GGTGACGGGTGACGGAGAATTAGGGTTCGATTCCGGAGAGGGAGCCTGAGAAACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCAATC
CTGACACGGGGAGGTAGTGACAATAAATAACAATACCGGGCGCATTAGTGTCTGGTAATTGGAATGAGTACAATCTAAATCCCTTAACGAGGATCCATTG
GAGGGATTGCTAACAGAGAAGAGTGCCCTGCCCCGCGGAGGAAAATTAGTAGCCAGCAAGAACGCGGATCATGAAGGCGCCCGGTCGGTAGATTTCTTTG
ATCCATCTTGTTTGTTCACCTTGCTGTATAGAAAGATGAGAGATGAGCGATCGGAACCGATGCATTctgagttagtagtgat
page-top