Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1753  (registered. 2007)
Contig Information
Length 829 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Ras-related protein Rab-6A, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 915
Evalue 8.40931e-97
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig1753
attcggcacgaggcacgcacctccacgactcgatccaaatcactccggggagcgtccaactcggagcagaagagatcgcccgacgagctagctccgggcc
gagcaagcaagctagccatggcgccggcggtgtcggcgctggccaagtacaagctggtgttcctcggcgaccaggcggtgggcaagaccgccatcatcac
ccgcttcatgtacgacaagttcgacgccacctaccaggccaccatcgggatcgaTTTCCTCTCCAAGACCATGTACCTCGAGGACCGCACGGTTCGCCTG
CAGCTATGGGACACGGCTGGGCAGgagagGTTCCGGAGTCTGATTCCAAGCTACATCAGAGACTCTTCTGTCGCGGTCATCGTCTACGATGTAACTGACA
CGCAATCGTTTCTTCATACATCGAAGTGGATCGATGAGGTGAACAcggcaagaggcaaagatgtgctgatcgtgctcgtcggaaacaaaacagacctcgt
tgaccagaggcaagtgcccacggacgaaggggaggccaaggccaaggagcacggcgccttgttcatggagaccagcgccaaggccggcttcaacatcaag
gctctgttccgcacgatcgccgcgtccctgcctgggatggacgccctctcgtcggcgaagcaggaggacatggtggacatcaacctgaggcccgcctccg
ggccagcaggctcaggcgcgcctgggcagcaggagcagaaagcaggaggatgctcttgctgagctttgtgttcttttattagaggagagatttttagcaa
gaatgtaatttnaccaaaacagattgcgg
page-top