Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1752  (registered. 2007)
Contig Information
Length 354 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_16343 [Oryza sativa Indica Group]
Score 231
Evalue 4.93024e-18
Total Hit Count 40
Registered year 2007
Contig Sequence     [ Download ]
>Contig1752
gggacggccagagCGTGGtcaccaGCCCATGCCGGTGCCTGAGCGCGGACAACAGCTGCGACCCGGAGAGCCAGTGGTTCAAGCTGGTGAGCAGCACGAG
GAGCGTCGCCGCCAATAGCATGCTCGCGGAGCTGCCTGTGAAACTCGTGAGCTCGAAGATTCGCTCGCTTTGATCGGTACCGGTAGGACCGACATATATA
ATTGTATAGGTGCACGCATCCGTTGTAGCTGCAAAGGCGCCGAGATGGACGAGAGAAGCTGCTCTAGAACTGGAGTAATATCCTTCAGAATTCAGGTAAC
TGAATGAATGCTGGGGCactggagcacgatggccccaatcttgcaaaaaaaaaa
page-top