Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1621  (registered. 2007)
Contig Information
Length 273 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Phosphoenolpyruvate carboxylase 1; Short=PEPCase 1; Short=PEPC 1; AltName: Full=CP21 >gi|21630|emb|CAA39197.1| phosphoenolpyruvate carboxylase [Sorghum bicolor] >gi|22615|emb|CAA46267.1| phosphoenolpyruvate carboxylase [Sorghum bicolor] (no hit)
Score 1079
Evalue 4.61078e-116
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>Contig1621
ggaattcggcacgaggtCGGAGTGGctacacaAGTTGAGATGGAGCTAATGCTCGGTTGAACAGATTATCTGTATGCACAACACCTTTAGGTTACTTGCA
TTCCGAATTTGAAAAAACTTGTAGAATGAGCAAAATTTATTGGGAGCTATCGGAGGAGTGTGATCATTGGAACATCAGTTCTGATGATACGGTCATCACT
AGCTTGGATTATACAAGAAAATCCCAAAACGAtcctggcCCAAACcggttactggttacattgaaaaaaaaaa
page-top