Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig804  (registered. 2012)
Contig Information
Length 762 bp
Clones alternative view 25 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_e Seed DPA10 1
Wh_r Root 1
Wh_CSEC Callus 2
Wh_DPA20 Seed DPA20 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|108863914|gb|ABG22330.1|| Macrophage migration inhibitory factor family protein, expressed"
Score 218
Evalue 7.00E-55
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig804
AGAGCCTATGCCCACCAAAGGTATGTTCCACAGTTGCAGGGTGCACCTTATGCAAATCCTGAATTTTAGCTCATGCAGCAAATCACTGGAACTCAACAAC
CAGCACAAACACAGAGGACACCAAAAGGCTTCATGATTACGAATCGAGTCAAACCGAACAGTTGCGACGATCCCTTGCCATGGCAAGTCCCAAACCAAAC
CAACTAGATCACACAAGTACTCCGGTACTCATAAACACTGGCCATTAAACTGACACGATGTCTTACTGCAGCAGTTTCTCCTTAAATAGGCAGTGGACAG
AATATTAGGAACTCTGGAGTTCATGCAAGGCTCCATGCCATATGATGCGTCTAAAAGGTGGATCCATTCCATCCAAAGTCTGAGCGCTTTGAATCGTGGA
ACTTGAGGTAGAAGCGGGACTTGGGGATGGACAGCTTTGACTCCAGGATGGAAGCAATGCCGGCACTCAGCTTCTTGTTCACATCAGCGTTCAGCCCTCC
GATGGAAACCAGCTCGCCGTAGGCTGCAGGCTCCTGGGTACCTCCAAATGCCATGGGCACTGAACCCTTGAGAACAACCATAACATAGGCCTCCGGCTTG
CCGATGATGGTTGCGACGGTGCTGGAGGCGTCGGCGAGGACGGCGGAGGTGTCCACCCCCTCCAGGTTCACGTTCGTCGACACGTTCAGGCAAGGCATCT
TCCTCCTCCGCTTCTTCCTTCTTCTTCTCCCCTGTCTGCGCCTTGGGCACGAGGCCTCGTGC
page-top