Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig1402  (registered. 2007)
Contig Information
Length 660 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_17699 [Oryza sativa Indica Group]
Score 696
Evalue 1.33135e-71
Total Hit Count 40
Registered year 2007
Contig Sequence     [ Download ]
>Contig1402
cggaccgccgccgccgtctgcacccaaagcaatacgccgccgcgccgcctccctcccagccgccatctctttccgacgccgcggaagagaaggccgtccg
aggacaagccaagcaccaacaaccctttccccttcctttgcccccgcacccgtcCGATGGGCGAGCGGCTCGCCGGCGCCGAGAAAGAGGTGCTCGTGGA
GatcgtGAGGTTCACCCAGAAGAACGGCCTGAAGGGGGCCGAGGGGGGATGGAAGGATTTCCTGgcccggaACGACAAGAAGTTCGGCGCCTCCGTCAGC
GACCCCAAGAAGCGGACCAAGGACGTGCTGCTCGCGTTCcttgtAACCTTCTCCAAAGATTTTCAGAAGTActtccgCAAATTGGTGAGGCGTCACGCTG
AACGGAGAGCTATCGAGCAGtacatGAATGAGTTTTCCGGCAaggtttctcctgaGCAGAAGCTTGTTCAGTTGACGACAgaacaCCTTGACTACAGGAA
AAACTACTACTTCCCATCTTATCAAGAGGGGTGgaaaataatgcggataggaaaagtttctagtagtatgaactctggagtcatgttggcaattgactgt
gagatggtcctttgccacgatggtacagaagctgtcgtccgagtatgtgttgtagacaac
page-top